Incidental Mutation 'R8347:Adamts15'
ID 645306
Institutional Source Beutler Lab
Gene Symbol Adamts15
Ensembl Gene ENSMUSG00000033453
Gene Name a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 15
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8347 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 30899155-30922452 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 30902550 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 773 (R773Q)
Ref Sequence ENSEMBL: ENSMUSP00000067022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065112]
AlphaFold P59384
Predicted Effect probably benign
Transcript: ENSMUST00000065112
AA Change: R773Q

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000067022
Gene: ENSMUSG00000033453
AA Change: R773Q

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Pep_M12B_propep 24 157 8.7e-27 PFAM
Pfam:Reprolysin_4 216 422 8.2e-7 PFAM
Pfam:Reprolysin_5 217 404 7.2e-13 PFAM
Pfam:Reprolysin 218 427 3.7e-20 PFAM
Pfam:Reprolysin_3 240 372 6.1e-10 PFAM
Blast:ACR 429 507 1e-25 BLAST
TSP1 519 571 7.85e-12 SMART
Pfam:ADAM_spacer1 683 801 7.1e-36 PFAM
TSP1 842 895 3e-8 SMART
TSP1 896 949 4.21e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active versicanase enzyme. This gene is located adjacent to a related ADAMTS gene (Adamts8) on chromosome 9. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T A 13: 59,742,236 D590V possibly damaging Het
1700123K08Rik T A 5: 138,562,891 I170L probably benign Het
Ankib1 A G 5: 3,747,065 L249P probably damaging Het
Cabin1 A G 10: 75,742,367 F499L probably damaging Het
Clec12b C T 6: 129,380,487 probably null Het
Col23a1 G A 11: 51,571,256 G373D probably damaging Het
Cse1l C T 2: 166,927,585 T304I possibly damaging Het
D6Wsu163e T A 6: 126,955,288 L330* probably null Het
Dbi A C 1: 120,120,820 L32R possibly damaging Het
Dennd2c A G 3: 103,157,709 Y716C probably damaging Het
Dnah5 G A 15: 28,236,666 M379I possibly damaging Het
Dpys T C 15: 39,857,313 D17G probably benign Het
Dync2h1 C T 9: 7,116,578 S2319N possibly damaging Het
Dyrk2 T C 10: 118,859,983 K457E probably damaging Het
Efs A G 14: 54,919,784 C357R probably benign Het
Egfr T A 11: 16,878,174 W516R probably damaging Het
Folh1 T A 7: 86,729,118 R529* probably null Het
Fsip2 A C 2: 82,987,854 I4644L probably benign Het
Garnl3 T C 2: 33,085,891 Y66C probably damaging Het
Gli3 T C 13: 15,723,525 L730P probably damaging Het
Gm19668 T C 10: 77,798,387 *249W probably null Het
Gm28710 G A 5: 16,801,574 M96I probably benign Het
Ighv2-6-8 T C 12: 113,796,327 D54G probably benign Het
Irs2 C A 8: 11,008,000 S144I possibly damaging Het
Itgb5 T C 16: 33,940,678 C628R probably damaging Het
Kcnh4 A T 11: 100,757,749 V43D probably damaging Het
Krtap16-3 A T 16: 88,962,619 Y69N unknown Het
Lcn12 A C 2: 25,492,033 D176E possibly damaging Het
Lilr4b T A 10: 51,481,754 F181L probably damaging Het
Med13l T A 5: 118,742,597 H1251Q probably benign Het
Nppb C A 4: 147,986,299 L44M probably damaging Het
Nutm2 T C 13: 50,472,337 V320A probably benign Het
Olfr1272 A T 2: 90,281,676 W300R probably benign Het
Olfr291 C T 7: 84,856,755 P131S probably damaging Het
Olfr628 A G 7: 103,731,943 S6G probably benign Het
Olfr987 T A 2: 85,331,703 H65L probably damaging Het
Padi6 T C 4: 140,735,408 M301V probably benign Het
Pappa G A 4: 65,327,065 R1530Q probably damaging Het
Pcgf6 C T 19: 47,045,838 D255N possibly damaging Het
Pgap3 TCAGCAGCAGCAGCAGCAG TCAGCAGCAGCAGCAG 11: 98,390,749 probably benign Het
Phip A G 9: 82,908,763 I710T probably benign Het
Pla2r1 A T 2: 60,534,903 Y108N probably damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Rint1 C G 5: 23,811,772 L512V probably damaging Het
Sdad1 A C 5: 92,298,229 F282L probably benign Het
Sirt5 G T 13: 43,380,501 A189S probably benign Het
Slc14a1 T C 18: 78,111,431 T247A probably benign Het
Slc22a6 C G 19: 8,621,805 R267G probably damaging Het
Slfn3 A G 11: 83,213,589 K429E possibly damaging Het
Spag17 T C 3: 100,027,641 F721S probably benign Het
St3gal1 G A 15: 67,113,662 R48C probably damaging Het
Sult2a6 A G 7: 14,225,958 Y217H probably benign Het
Synj2 A G 17: 6,009,785 N394S probably damaging Het
Telo2 A T 17: 25,104,637 Y605* probably null Het
Trank1 T A 9: 111,367,249 L1447Q probably damaging Het
Trim56 A G 5: 137,112,592 L690P probably damaging Het
Trmt13 T C 3: 116,582,768 T325A probably benign Het
Ttn T A 2: 76,709,467 T34392S probably benign Het
Uncx A G 5: 139,546,816 E212G probably damaging Het
Ush2a A G 1: 188,947,084 T4830A probably benign Het
Usp34 C A 11: 23,412,345 T1616N Het
Vars C T 17: 35,015,977 L1261F possibly damaging Het
Vmn1r223 T C 13: 23,249,850 S205P probably damaging Het
Vmn2r118 A T 17: 55,610,423 I363K possibly damaging Het
Vmn2r69 A T 7: 85,415,630 M16K probably benign Het
Wdr62 G A 7: 30,262,703 T428I possibly damaging Het
Yeats4 A T 10: 117,217,469 L129Q probably benign Het
Zfp423 T C 8: 87,783,156 R187G probably damaging Het
Zfp853 A T 5: 143,288,947 L321Q unknown Het
Other mutations in Adamts15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Adamts15 APN 9 30902053 missense probably damaging 1.00
IGL01325:Adamts15 APN 9 30921688 missense possibly damaging 0.86
IGL01506:Adamts15 APN 9 30922134 missense probably benign 0.08
IGL01897:Adamts15 APN 9 30902152 missense probably damaging 1.00
IGL02137:Adamts15 APN 9 30910660 missense probably damaging 1.00
IGL02876:Adamts15 APN 9 30904522 missense probably damaging 0.98
IGL02997:Adamts15 APN 9 30906057 splice site probably benign
IGL03094:Adamts15 APN 9 30904472 splice site probably benign
IGL03146:Adamts15 APN 9 30921567 missense probably damaging 0.99
IGL03241:Adamts15 APN 9 30904485 missense probably damaging 1.00
Awareness UTSW 9 30911108 critical splice donor site probably null
heightened UTSW 9 30904770 missense probably damaging 1.00
Pugsley UTSW 9 30906158 missense probably damaging 1.00
sparticus UTSW 9 30910602 missense probably benign 0.40
R0118:Adamts15 UTSW 9 30911744 missense probably damaging 1.00
R0635:Adamts15 UTSW 9 30904770 missense probably damaging 1.00
R0827:Adamts15 UTSW 9 30921480 missense probably damaging 1.00
R0946:Adamts15 UTSW 9 30902197 missense probably damaging 1.00
R1608:Adamts15 UTSW 9 30902479 missense probably damaging 0.99
R1806:Adamts15 UTSW 9 30904815 missense probably damaging 1.00
R1954:Adamts15 UTSW 9 30910708 missense probably benign
R1967:Adamts15 UTSW 9 30921309 nonsense probably null
R2009:Adamts15 UTSW 9 30922137 missense probably benign 0.17
R2129:Adamts15 UTSW 9 30904503 missense probably benign 0.05
R2329:Adamts15 UTSW 9 30902485 missense probably damaging 1.00
R2991:Adamts15 UTSW 9 30921394 missense probably benign
R3970:Adamts15 UTSW 9 30910602 missense probably benign 0.40
R4212:Adamts15 UTSW 9 30906174 missense probably damaging 0.99
R4326:Adamts15 UTSW 9 30904518 missense probably benign
R4329:Adamts15 UTSW 9 30904518 missense probably benign
R4594:Adamts15 UTSW 9 30921447 missense probably damaging 0.99
R5110:Adamts15 UTSW 9 30921444 missense probably benign 0.01
R5120:Adamts15 UTSW 9 30921576 missense probably damaging 1.00
R5697:Adamts15 UTSW 9 30911794 missense probably damaging 1.00
R5901:Adamts15 UTSW 9 30902490 missense probably damaging 1.00
R6011:Adamts15 UTSW 9 30902786 missense probably damaging 0.98
R6020:Adamts15 UTSW 9 30902062 missense probably benign 0.03
R6651:Adamts15 UTSW 9 30922152 missense probably damaging 0.98
R6665:Adamts15 UTSW 9 30904479 critical splice donor site probably null
R7021:Adamts15 UTSW 9 30921480 missense probably damaging 1.00
R7231:Adamts15 UTSW 9 30906158 missense probably damaging 1.00
R7290:Adamts15 UTSW 9 30902610 missense probably benign 0.05
R7390:Adamts15 UTSW 9 30911108 critical splice donor site probably null
R7798:Adamts15 UTSW 9 30904643 missense probably damaging 1.00
R7833:Adamts15 UTSW 9 30922105 missense probably benign
R7908:Adamts15 UTSW 9 30902226 missense probably benign
R8175:Adamts15 UTSW 9 30904656 missense probably damaging 1.00
R8177:Adamts15 UTSW 9 30922026 missense probably damaging 1.00
R8348:Adamts15 UTSW 9 30902550 missense probably benign 0.07
R8374:Adamts15 UTSW 9 30902706 missense probably benign 0.21
R8473:Adamts15 UTSW 9 30904789 missense probably damaging 1.00
R8680:Adamts15 UTSW 9 30911759 missense possibly damaging 0.57
R9113:Adamts15 UTSW 9 30911202 missense probably damaging 1.00
R9336:Adamts15 UTSW 9 30904789 missense probably damaging 1.00
R9381:Adamts15 UTSW 9 30902520 missense probably damaging 0.99
X0063:Adamts15 UTSW 9 30922230 missense possibly damaging 0.96
X0067:Adamts15 UTSW 9 30921582 missense probably damaging 1.00
Z1176:Adamts15 UTSW 9 30910700 missense probably damaging 1.00
Z1177:Adamts15 UTSW 9 30902491 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGAGGTCTGTTATCTGGC -3'
(R):5'- AGCATTGATATCCGTCAGCG -3'

Sequencing Primer
(F):5'- CTGCTCTACTTGGTTGGAAAGGC -3'
(R):5'- ATATCCGTCAGCGTGGTTACAAG -3'
Posted On 2020-09-02