Incidental Mutation 'R8347:Yeats4'
ID 645312
Institutional Source Beutler Lab
Gene Symbol Yeats4
Ensembl Gene ENSMUSG00000020171
Gene Name YEATS domain containing 4
Synonyms 4930573H17Rik, NuBI-1, GAS41, B230215M10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock # R8347 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 117215221-117224507 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 117217469 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 129 (L129Q)
Ref Sequence ENSEMBL: ENSMUSP00000020382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020382] [ENSMUST00000218887]
AlphaFold Q9CR11
Predicted Effect probably benign
Transcript: ENSMUST00000020382
AA Change: L129Q

PolyPhen 2 Score 0.262 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000020382
Gene: ENSMUSG00000020171
AA Change: L129Q

DomainStartEndE-ValueType
Pfam:YEATS 44 124 4.6e-38 PFAM
low complexity region 152 163 N/A INTRINSIC
coiled coil region 178 226 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218887
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in the nucleoli. It has high sequence homology to human MLLT1, and yeast and human MLLT3 proteins. Both MLLT1 and MLLT3 proteins belong to a class of transcription factors, indicating that the encoded protein might also represent a transcription factor. This protein is thought to be required for RNA transcription. This gene has been shown to be amplified in tumors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T A 13: 59,742,236 D590V possibly damaging Het
1700123K08Rik T A 5: 138,562,891 I170L probably benign Het
Adamts15 C T 9: 30,902,550 R773Q probably benign Het
Ankib1 A G 5: 3,747,065 L249P probably damaging Het
Cabin1 A G 10: 75,742,367 F499L probably damaging Het
Clec12b C T 6: 129,380,487 probably null Het
Col23a1 G A 11: 51,571,256 G373D probably damaging Het
Cse1l C T 2: 166,927,585 T304I possibly damaging Het
D6Wsu163e T A 6: 126,955,288 L330* probably null Het
Dbi A C 1: 120,120,820 L32R possibly damaging Het
Dennd2c A G 3: 103,157,709 Y716C probably damaging Het
Dnah5 G A 15: 28,236,666 M379I possibly damaging Het
Dpys T C 15: 39,857,313 D17G probably benign Het
Dync2h1 C T 9: 7,116,578 S2319N possibly damaging Het
Dyrk2 T C 10: 118,859,983 K457E probably damaging Het
Efs A G 14: 54,919,784 C357R probably benign Het
Egfr T A 11: 16,878,174 W516R probably damaging Het
Folh1 T A 7: 86,729,118 R529* probably null Het
Fsip2 A C 2: 82,987,854 I4644L probably benign Het
Garnl3 T C 2: 33,085,891 Y66C probably damaging Het
Gli3 T C 13: 15,723,525 L730P probably damaging Het
Gm19668 T C 10: 77,798,387 *249W probably null Het
Gm28710 G A 5: 16,801,574 M96I probably benign Het
Ighv2-6-8 T C 12: 113,796,327 D54G probably benign Het
Irs2 C A 8: 11,008,000 S144I possibly damaging Het
Itgb5 T C 16: 33,940,678 C628R probably damaging Het
Kcnh4 A T 11: 100,757,749 V43D probably damaging Het
Krtap16-3 A T 16: 88,962,619 Y69N unknown Het
Lcn12 A C 2: 25,492,033 D176E possibly damaging Het
Lilr4b T A 10: 51,481,754 F181L probably damaging Het
Med13l T A 5: 118,742,597 H1251Q probably benign Het
Nppb C A 4: 147,986,299 L44M probably damaging Het
Nutm2 T C 13: 50,472,337 V320A probably benign Het
Olfr1272 A T 2: 90,281,676 W300R probably benign Het
Olfr291 C T 7: 84,856,755 P131S probably damaging Het
Olfr628 A G 7: 103,731,943 S6G probably benign Het
Olfr987 T A 2: 85,331,703 H65L probably damaging Het
Padi6 T C 4: 140,735,408 M301V probably benign Het
Pappa G A 4: 65,327,065 R1530Q probably damaging Het
Pcgf6 C T 19: 47,045,838 D255N possibly damaging Het
Pgap3 TCAGCAGCAGCAGCAGCAG TCAGCAGCAGCAGCAG 11: 98,390,749 probably benign Het
Phip A G 9: 82,908,763 I710T probably benign Het
Pla2r1 A T 2: 60,534,903 Y108N probably damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Rint1 C G 5: 23,811,772 L512V probably damaging Het
Sdad1 A C 5: 92,298,229 F282L probably benign Het
Sirt5 G T 13: 43,380,501 A189S probably benign Het
Slc14a1 T C 18: 78,111,431 T247A probably benign Het
Slc22a6 C G 19: 8,621,805 R267G probably damaging Het
Slfn3 A G 11: 83,213,589 K429E possibly damaging Het
Spag17 T C 3: 100,027,641 F721S probably benign Het
St3gal1 G A 15: 67,113,662 R48C probably damaging Het
Sult2a6 A G 7: 14,225,958 Y217H probably benign Het
Synj2 A G 17: 6,009,785 N394S probably damaging Het
Telo2 A T 17: 25,104,637 Y605* probably null Het
Trank1 T A 9: 111,367,249 L1447Q probably damaging Het
Trim56 A G 5: 137,112,592 L690P probably damaging Het
Trmt13 T C 3: 116,582,768 T325A probably benign Het
Ttn T A 2: 76,709,467 T34392S probably benign Het
Uncx A G 5: 139,546,816 E212G probably damaging Het
Ush2a A G 1: 188,947,084 T4830A probably benign Het
Usp34 C A 11: 23,412,345 T1616N Het
Vars C T 17: 35,015,977 L1261F possibly damaging Het
Vmn1r223 T C 13: 23,249,850 S205P probably damaging Het
Vmn2r118 A T 17: 55,610,423 I363K possibly damaging Het
Vmn2r69 A T 7: 85,415,630 M16K probably benign Het
Wdr62 G A 7: 30,262,703 T428I possibly damaging Het
Zfp423 T C 8: 87,783,156 R187G probably damaging Het
Zfp853 A T 5: 143,288,947 L321Q unknown Het
Other mutations in Yeats4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02383:Yeats4 APN 10 117215811 missense probably benign 0.01
R0305:Yeats4 UTSW 10 117215836 missense probably damaging 0.99
R1606:Yeats4 UTSW 10 117217439 missense probably damaging 1.00
R1703:Yeats4 UTSW 10 117215723 missense probably benign
R1907:Yeats4 UTSW 10 117215731 missense probably benign 0.17
R3156:Yeats4 UTSW 10 117222281 missense probably benign 0.11
R3625:Yeats4 UTSW 10 117220368 missense probably benign 0.08
R5687:Yeats4 UTSW 10 117215680 missense probably benign
R7900:Yeats4 UTSW 10 117220559 missense possibly damaging 0.95
R8514:Yeats4 UTSW 10 117215755 missense possibly damaging 0.50
R9665:Yeats4 UTSW 10 117217438 nonsense probably null
R9688:Yeats4 UTSW 10 117215681 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCGTTGGGTCTTGAAATATCTTAAG -3'
(R):5'- TAATTCCGCCTCAGCCTACG -3'

Sequencing Primer
(F):5'- GGAATAAAACGAGACAAAAAGCCC -3'
(R):5'- GCTTGTAACCTTAGCCCTTGAGAAG -3'
Posted On 2020-09-02