Incidental Mutation 'R8347:Gli3'
ID 645321
Institutional Source Beutler Lab
Gene Symbol Gli3
Ensembl Gene ENSMUSG00000021318
Gene Name GLI-Kruppel family member GLI3
Synonyms Bph, brachyphalangy
MMRRC Submission 067867-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8347 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 15638308-15904611 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 15898110 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 730 (L730P)
Ref Sequence ENSEMBL: ENSMUSP00000106137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110510]
AlphaFold Q61602
Predicted Effect probably damaging
Transcript: ENSMUST00000110510
AA Change: L730P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106137
Gene: ENSMUSG00000021318
AA Change: L730P

DomainStartEndE-ValueType
low complexity region 120 136 N/A INTRINSIC
low complexity region 204 220 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 403 421 N/A INTRINSIC
ZnF_C2H2 480 505 1.53e-1 SMART
ZnF_C2H2 513 540 1.23e0 SMART
ZnF_C2H2 546 570 3.16e-3 SMART
ZnF_C2H2 576 601 4.17e-3 SMART
ZnF_C2H2 607 632 1.4e-4 SMART
low complexity region 703 726 N/A INTRINSIC
low complexity region 756 763 N/A INTRINSIC
low complexity region 849 880 N/A INTRINSIC
low complexity region 934 944 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1166 1175 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the C2H2-type zinc finger proteins subclass of the Gli family. They are characterized as DNA-binding transcription factors and are mediators of Sonic hedgehog (Shh) signaling. The protein encoded by this gene localizes in the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. Mutations in this gene have been associated with several diseases, including Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, and postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants die perinatally with gross polydactyly, multiple craniofacial defects, and frequently, exencephaly. Heterozygotes exhibit enlarged interfrontal bone and extra preaxial digits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik T A 5: 138,561,153 (GRCm39) I170L probably benign Het
Adamts15 C T 9: 30,813,846 (GRCm39) R773Q probably benign Het
Ankib1 A G 5: 3,797,065 (GRCm39) L249P probably damaging Het
Cabin1 A G 10: 75,578,201 (GRCm39) F499L probably damaging Het
Cdhr17 G A 5: 17,006,572 (GRCm39) M96I probably benign Het
Clec12b C T 6: 129,357,450 (GRCm39) probably null Het
Col23a1 G A 11: 51,462,083 (GRCm39) G373D probably damaging Het
Cse1l C T 2: 166,769,505 (GRCm39) T304I possibly damaging Het
D6Wsu163e T A 6: 126,932,251 (GRCm39) L330* probably null Het
Dbi A C 1: 120,048,550 (GRCm39) L32R possibly damaging Het
Dennd2c A G 3: 103,065,025 (GRCm39) Y716C probably damaging Het
Dnah5 G A 15: 28,236,812 (GRCm39) M379I possibly damaging Het
Dpys T C 15: 39,720,709 (GRCm39) D17G probably benign Het
Dync2h1 C T 9: 7,116,578 (GRCm39) S2319N possibly damaging Het
Dyrk2 T C 10: 118,695,888 (GRCm39) K457E probably damaging Het
Efs A G 14: 55,157,241 (GRCm39) C357R probably benign Het
Egfr T A 11: 16,828,174 (GRCm39) W516R probably damaging Het
Folh1 T A 7: 86,378,326 (GRCm39) R529* probably null Het
Fsip2 A C 2: 82,818,198 (GRCm39) I4644L probably benign Het
Garnl3 T C 2: 32,975,903 (GRCm39) Y66C probably damaging Het
Gm19668 T C 10: 77,634,221 (GRCm39) *249W probably null Het
Ighv2-6-8 T C 12: 113,759,947 (GRCm39) D54G probably benign Het
Irs2 C A 8: 11,058,000 (GRCm39) S144I possibly damaging Het
Itgb5 T C 16: 33,761,048 (GRCm39) C628R probably damaging Het
Kcnh4 A T 11: 100,648,575 (GRCm39) V43D probably damaging Het
Krtap16-3 A T 16: 88,759,507 (GRCm39) Y69N unknown Het
Lcn12 A C 2: 25,382,045 (GRCm39) D176E possibly damaging Het
Lilrb4b T A 10: 51,357,850 (GRCm39) F181L probably damaging Het
Med13l T A 5: 118,880,662 (GRCm39) H1251Q probably benign Het
Nppb C A 4: 148,070,756 (GRCm39) L44M probably damaging Het
Nutm2 T C 13: 50,626,373 (GRCm39) V320A probably benign Het
Or4b1b A T 2: 90,112,020 (GRCm39) W300R probably benign Het
Or52a24 A G 7: 103,381,150 (GRCm39) S6G probably benign Het
Or5ae2 C T 7: 84,505,963 (GRCm39) P131S probably damaging Het
Or5ak4 T A 2: 85,162,047 (GRCm39) H65L probably damaging Het
Padi6 T C 4: 140,462,719 (GRCm39) M301V probably benign Het
Pappa G A 4: 65,245,302 (GRCm39) R1530Q probably damaging Het
Pcgf6 C T 19: 47,034,277 (GRCm39) D255N possibly damaging Het
Pgap3 TCAGCAGCAGCAGCAGCAG TCAGCAGCAGCAGCAG 11: 98,281,575 (GRCm39) probably benign Het
Phip A G 9: 82,790,816 (GRCm39) I710T probably benign Het
Pla2r1 A T 2: 60,365,247 (GRCm39) Y108N probably damaging Het
Plat G T 8: 23,262,248 (GRCm39) G91W probably damaging Het
Rint1 C G 5: 24,016,770 (GRCm39) L512V probably damaging Het
Sdad1 A C 5: 92,446,088 (GRCm39) F282L probably benign Het
Sirt5 G T 13: 43,533,977 (GRCm39) A189S probably benign Het
Slc14a1 T C 18: 78,154,646 (GRCm39) T247A probably benign Het
Slc22a6 C G 19: 8,599,169 (GRCm39) R267G probably damaging Het
Slfn3 A G 11: 83,104,415 (GRCm39) K429E possibly damaging Het
Spag17 T C 3: 99,934,957 (GRCm39) F721S probably benign Het
Spata31d1e T A 13: 59,890,050 (GRCm39) D590V possibly damaging Het
St3gal1 G A 15: 66,985,511 (GRCm39) R48C probably damaging Het
Sult2a6 A G 7: 13,959,883 (GRCm39) Y217H probably benign Het
Synj2 A G 17: 6,060,060 (GRCm39) N394S probably damaging Het
Telo2 A T 17: 25,323,611 (GRCm39) Y605* probably null Het
Trank1 T A 9: 111,196,317 (GRCm39) L1447Q probably damaging Het
Trim56 A G 5: 137,141,446 (GRCm39) L690P probably damaging Het
Trmt13 T C 3: 116,376,417 (GRCm39) T325A probably benign Het
Ttn T A 2: 76,539,811 (GRCm39) T34392S probably benign Het
Uncx A G 5: 139,532,571 (GRCm39) E212G probably damaging Het
Ush2a A G 1: 188,679,281 (GRCm39) T4830A probably benign Het
Usp34 C A 11: 23,362,345 (GRCm39) T1616N Het
Vars1 C T 17: 35,234,953 (GRCm39) L1261F possibly damaging Het
Vmn1r223 T C 13: 23,434,020 (GRCm39) S205P probably damaging Het
Vmn2r118 A T 17: 55,917,423 (GRCm39) I363K possibly damaging Het
Vmn2r69 A T 7: 85,064,838 (GRCm39) M16K probably benign Het
Wdr62 G A 7: 29,962,128 (GRCm39) T428I possibly damaging Het
Yeats4 A T 10: 117,053,374 (GRCm39) L129Q probably benign Het
Zfp423 T C 8: 88,509,784 (GRCm39) R187G probably damaging Het
Zfp853 A T 5: 143,274,702 (GRCm39) L321Q unknown Het
Other mutations in Gli3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Gli3 APN 13 15,818,884 (GRCm39) missense probably damaging 1.00
IGL00471:Gli3 APN 13 15,898,354 (GRCm39) critical splice donor site probably null
IGL00484:Gli3 APN 13 15,818,977 (GRCm39) missense possibly damaging 0.84
IGL00588:Gli3 APN 13 15,818,977 (GRCm39) missense possibly damaging 0.84
IGL01161:Gli3 APN 13 15,722,983 (GRCm39) critical splice acceptor site probably null
IGL01633:Gli3 APN 13 15,823,219 (GRCm39) missense probably damaging 1.00
IGL01799:Gli3 APN 13 15,900,746 (GRCm39) missense probably benign 0.00
IGL01861:Gli3 APN 13 15,899,910 (GRCm39) missense probably damaging 1.00
IGL02063:Gli3 APN 13 15,900,957 (GRCm39) missense possibly damaging 0.94
IGL02112:Gli3 APN 13 15,837,099 (GRCm39) missense probably damaging 1.00
IGL02255:Gli3 APN 13 15,823,304 (GRCm39) missense probably damaging 1.00
IGL02270:Gli3 APN 13 15,901,371 (GRCm39) utr 3 prime probably benign
IGL02336:Gli3 APN 13 15,894,874 (GRCm39) missense probably damaging 1.00
IGL02346:Gli3 APN 13 15,898,278 (GRCm39) missense probably damaging 1.00
IGL02744:Gli3 APN 13 15,788,471 (GRCm39) critical splice donor site probably null
IGL02877:Gli3 APN 13 15,899,327 (GRCm39) missense probably damaging 1.00
IGL02975:Gli3 APN 13 15,899,153 (GRCm39) missense probably damaging 1.00
IGL03018:Gli3 APN 13 15,834,717 (GRCm39) missense probably damaging 1.00
IGL03378:Gli3 APN 13 15,819,005 (GRCm39) missense probably damaging 1.00
IGL03406:Gli3 APN 13 15,823,166 (GRCm39) missense probably damaging 1.00
Capone UTSW 13 15,889,619 (GRCm39) missense probably damaging 1.00
Carpals UTSW 13 15,888,235 (GRCm39) critical splice donor site probably null
Ness UTSW 13 15,898,140 (GRCm39) missense probably damaging 1.00
FR4737:Gli3 UTSW 13 15,818,942 (GRCm39) missense probably damaging 1.00
R0110:Gli3 UTSW 13 15,899,370 (GRCm39) missense probably damaging 1.00
R0329:Gli3 UTSW 13 15,898,143 (GRCm39) missense probably damaging 0.98
R0330:Gli3 UTSW 13 15,898,143 (GRCm39) missense probably damaging 0.98
R0360:Gli3 UTSW 13 15,899,349 (GRCm39) missense probably benign 0.32
R0364:Gli3 UTSW 13 15,899,349 (GRCm39) missense probably benign 0.32
R0469:Gli3 UTSW 13 15,899,370 (GRCm39) missense probably damaging 1.00
R0616:Gli3 UTSW 13 15,836,991 (GRCm39) missense possibly damaging 0.75
R0639:Gli3 UTSW 13 15,899,300 (GRCm39) missense probably damaging 1.00
R1072:Gli3 UTSW 13 15,888,190 (GRCm39) missense probably damaging 1.00
R1257:Gli3 UTSW 13 15,900,581 (GRCm39) nonsense probably null
R1270:Gli3 UTSW 13 15,898,329 (GRCm39) missense probably benign 0.02
R1424:Gli3 UTSW 13 15,900,899 (GRCm39) missense probably benign 0.00
R1481:Gli3 UTSW 13 15,788,435 (GRCm39) missense probably damaging 0.99
R1596:Gli3 UTSW 13 15,900,056 (GRCm39) missense possibly damaging 0.74
R1628:Gli3 UTSW 13 15,900,897 (GRCm39) missense probably benign 0.00
R1721:Gli3 UTSW 13 15,900,882 (GRCm39) missense probably benign 0.27
R1797:Gli3 UTSW 13 15,888,097 (GRCm39) missense probably damaging 0.99
R1813:Gli3 UTSW 13 15,823,276 (GRCm39) missense probably damaging 1.00
R1819:Gli3 UTSW 13 15,900,377 (GRCm39) nonsense probably null
R1988:Gli3 UTSW 13 15,900,965 (GRCm39) missense probably benign
R2132:Gli3 UTSW 13 15,900,134 (GRCm39) missense possibly damaging 0.74
R2352:Gli3 UTSW 13 15,836,977 (GRCm39) missense probably benign 0.02
R3085:Gli3 UTSW 13 15,835,526 (GRCm39) missense probably damaging 1.00
R3177:Gli3 UTSW 13 15,900,567 (GRCm39) missense probably benign 0.28
R3277:Gli3 UTSW 13 15,900,567 (GRCm39) missense probably benign 0.28
R4162:Gli3 UTSW 13 15,899,700 (GRCm39) missense possibly damaging 0.93
R4497:Gli3 UTSW 13 15,898,156 (GRCm39) missense possibly damaging 0.74
R4526:Gli3 UTSW 13 15,888,216 (GRCm39) missense probably damaging 1.00
R4979:Gli3 UTSW 13 15,899,049 (GRCm39) missense possibly damaging 0.87
R5327:Gli3 UTSW 13 15,723,092 (GRCm39) missense probably damaging 0.99
R5395:Gli3 UTSW 13 15,889,535 (GRCm39) missense probably damaging 1.00
R5494:Gli3 UTSW 13 15,900,567 (GRCm39) missense probably benign 0.28
R5609:Gli3 UTSW 13 15,723,038 (GRCm39) missense possibly damaging 0.82
R5718:Gli3 UTSW 13 15,652,750 (GRCm39) critical splice donor site probably null
R5810:Gli3 UTSW 13 15,818,894 (GRCm39) missense probably damaging 0.99
R5896:Gli3 UTSW 13 15,900,765 (GRCm39) missense probably benign 0.00
R5930:Gli3 UTSW 13 15,723,210 (GRCm39) missense probably damaging 1.00
R5964:Gli3 UTSW 13 15,900,747 (GRCm39) nonsense probably null
R5985:Gli3 UTSW 13 15,898,140 (GRCm39) missense probably damaging 1.00
R6224:Gli3 UTSW 13 15,899,730 (GRCm39) missense probably benign
R6278:Gli3 UTSW 13 15,899,698 (GRCm39) missense possibly damaging 0.69
R6330:Gli3 UTSW 13 15,899,317 (GRCm39) missense probably damaging 1.00
R6383:Gli3 UTSW 13 15,898,140 (GRCm39) missense probably damaging 1.00
R6523:Gli3 UTSW 13 15,888,235 (GRCm39) critical splice donor site probably null
R7072:Gli3 UTSW 13 15,900,280 (GRCm39) missense possibly damaging 0.51
R7085:Gli3 UTSW 13 15,889,647 (GRCm39) missense probably damaging 1.00
R7228:Gli3 UTSW 13 15,899,087 (GRCm39) missense probably benign 0.00
R7327:Gli3 UTSW 13 15,900,144 (GRCm39) missense probably benign 0.02
R7451:Gli3 UTSW 13 15,900,876 (GRCm39) missense possibly damaging 0.50
R7974:Gli3 UTSW 13 15,900,841 (GRCm39) missense probably benign 0.00
R8167:Gli3 UTSW 13 15,900,228 (GRCm39) missense probably benign 0.00
R8170:Gli3 UTSW 13 15,894,793 (GRCm39) missense probably benign
R8199:Gli3 UTSW 13 15,900,576 (GRCm39) missense probably benign 0.08
R8247:Gli3 UTSW 13 15,901,360 (GRCm39) missense possibly damaging 0.82
R8332:Gli3 UTSW 13 15,888,133 (GRCm39) missense possibly damaging 0.58
R8559:Gli3 UTSW 13 15,834,717 (GRCm39) missense probably damaging 1.00
R8676:Gli3 UTSW 13 15,889,619 (GRCm39) missense probably damaging 1.00
R8905:Gli3 UTSW 13 15,901,116 (GRCm39) missense probably benign 0.01
R9099:Gli3 UTSW 13 15,901,320 (GRCm39) missense probably damaging 1.00
R9260:Gli3 UTSW 13 15,899,675 (GRCm39) missense probably damaging 0.99
R9317:Gli3 UTSW 13 15,889,658 (GRCm39) missense probably damaging 1.00
R9475:Gli3 UTSW 13 15,900,296 (GRCm39) missense possibly damaging 0.87
R9546:Gli3 UTSW 13 15,788,443 (GRCm39) missense probably benign 0.00
R9571:Gli3 UTSW 13 15,900,858 (GRCm39) missense probably benign 0.00
R9621:Gli3 UTSW 13 15,901,253 (GRCm39) missense probably benign 0.01
R9704:Gli3 UTSW 13 15,898,058 (GRCm39) missense probably damaging 1.00
R9787:Gli3 UTSW 13 15,900,386 (GRCm39) missense probably damaging 0.96
RF010:Gli3 UTSW 13 15,900,954 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGGCTTGCATGAACTGTC -3'
(R):5'- TGGGACGTACCATTTCCTATGAG -3'

Sequencing Primer
(F):5'- GCATGAACTGTCATTTTGGCTC -3'
(R):5'- AGGGTTCAGTCTTGGAAACATTC -3'
Posted On 2020-09-02