Incidental Mutation 'R8347:Efs'
ID 645326
Institutional Source Beutler Lab
Gene Symbol Efs
Ensembl Gene ENSMUSG00000022203
Gene Name embryonal Fyn-associated substrate
Synonyms
MMRRC Submission 067867-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.127) question?
Stock # R8347 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 55153992-55163583 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 55157241 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 357 (C357R)
Ref Sequence ENSEMBL: ENSMUSP00000022813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022813] [ENSMUST00000227037] [ENSMUST00000227587]
AlphaFold Q64355
Predicted Effect probably benign
Transcript: ENSMUST00000022813
AA Change: C357R

PolyPhen 2 Score 0.285 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000022813
Gene: ENSMUSG00000022203
AA Change: C357R

DomainStartEndE-ValueType
SH3 8 67 5.15e-19 SMART
low complexity region 201 215 N/A INTRINSIC
low complexity region 255 273 N/A INTRINSIC
low complexity region 305 325 N/A INTRINSIC
low complexity region 335 351 N/A INTRINSIC
Pfam:DUF3513 370 555 9.2e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227037
AA Change: C264R

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000227587
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The longest protein isoform encoded by this gene contains an SH3 domain, which is known to be important in intracellular signal transduction. The protein encoded by a similiar gene in mice was shown to bind to SH3 domains of protein-tyrosine kinases. The function of this gene is unknown. Three alternatively spliced variants encoding different isoforms have been described for this gene. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a disruption in this gene display an increased inflammatory response characterized by excessive T cell responses, enhanced cytokine secretion and antibody production, and intestinal, kidney, liver, and lung inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik T A 5: 138,561,153 (GRCm39) I170L probably benign Het
Adamts15 C T 9: 30,813,846 (GRCm39) R773Q probably benign Het
Ankib1 A G 5: 3,797,065 (GRCm39) L249P probably damaging Het
Cabin1 A G 10: 75,578,201 (GRCm39) F499L probably damaging Het
Cdhr17 G A 5: 17,006,572 (GRCm39) M96I probably benign Het
Clec12b C T 6: 129,357,450 (GRCm39) probably null Het
Col23a1 G A 11: 51,462,083 (GRCm39) G373D probably damaging Het
Cse1l C T 2: 166,769,505 (GRCm39) T304I possibly damaging Het
D6Wsu163e T A 6: 126,932,251 (GRCm39) L330* probably null Het
Dbi A C 1: 120,048,550 (GRCm39) L32R possibly damaging Het
Dennd2c A G 3: 103,065,025 (GRCm39) Y716C probably damaging Het
Dnah5 G A 15: 28,236,812 (GRCm39) M379I possibly damaging Het
Dpys T C 15: 39,720,709 (GRCm39) D17G probably benign Het
Dync2h1 C T 9: 7,116,578 (GRCm39) S2319N possibly damaging Het
Dyrk2 T C 10: 118,695,888 (GRCm39) K457E probably damaging Het
Egfr T A 11: 16,828,174 (GRCm39) W516R probably damaging Het
Folh1 T A 7: 86,378,326 (GRCm39) R529* probably null Het
Fsip2 A C 2: 82,818,198 (GRCm39) I4644L probably benign Het
Garnl3 T C 2: 32,975,903 (GRCm39) Y66C probably damaging Het
Gli3 T C 13: 15,898,110 (GRCm39) L730P probably damaging Het
Gm19668 T C 10: 77,634,221 (GRCm39) *249W probably null Het
Ighv2-6-8 T C 12: 113,759,947 (GRCm39) D54G probably benign Het
Irs2 C A 8: 11,058,000 (GRCm39) S144I possibly damaging Het
Itgb5 T C 16: 33,761,048 (GRCm39) C628R probably damaging Het
Kcnh4 A T 11: 100,648,575 (GRCm39) V43D probably damaging Het
Krtap16-3 A T 16: 88,759,507 (GRCm39) Y69N unknown Het
Lcn12 A C 2: 25,382,045 (GRCm39) D176E possibly damaging Het
Lilrb4b T A 10: 51,357,850 (GRCm39) F181L probably damaging Het
Med13l T A 5: 118,880,662 (GRCm39) H1251Q probably benign Het
Nppb C A 4: 148,070,756 (GRCm39) L44M probably damaging Het
Nutm2 T C 13: 50,626,373 (GRCm39) V320A probably benign Het
Or4b1b A T 2: 90,112,020 (GRCm39) W300R probably benign Het
Or52a24 A G 7: 103,381,150 (GRCm39) S6G probably benign Het
Or5ae2 C T 7: 84,505,963 (GRCm39) P131S probably damaging Het
Or5ak4 T A 2: 85,162,047 (GRCm39) H65L probably damaging Het
Padi6 T C 4: 140,462,719 (GRCm39) M301V probably benign Het
Pappa G A 4: 65,245,302 (GRCm39) R1530Q probably damaging Het
Pcgf6 C T 19: 47,034,277 (GRCm39) D255N possibly damaging Het
Pgap3 TCAGCAGCAGCAGCAGCAG TCAGCAGCAGCAGCAG 11: 98,281,575 (GRCm39) probably benign Het
Phip A G 9: 82,790,816 (GRCm39) I710T probably benign Het
Pla2r1 A T 2: 60,365,247 (GRCm39) Y108N probably damaging Het
Plat G T 8: 23,262,248 (GRCm39) G91W probably damaging Het
Rint1 C G 5: 24,016,770 (GRCm39) L512V probably damaging Het
Sdad1 A C 5: 92,446,088 (GRCm39) F282L probably benign Het
Sirt5 G T 13: 43,533,977 (GRCm39) A189S probably benign Het
Slc14a1 T C 18: 78,154,646 (GRCm39) T247A probably benign Het
Slc22a6 C G 19: 8,599,169 (GRCm39) R267G probably damaging Het
Slfn3 A G 11: 83,104,415 (GRCm39) K429E possibly damaging Het
Spag17 T C 3: 99,934,957 (GRCm39) F721S probably benign Het
Spata31d1e T A 13: 59,890,050 (GRCm39) D590V possibly damaging Het
St3gal1 G A 15: 66,985,511 (GRCm39) R48C probably damaging Het
Sult2a6 A G 7: 13,959,883 (GRCm39) Y217H probably benign Het
Synj2 A G 17: 6,060,060 (GRCm39) N394S probably damaging Het
Telo2 A T 17: 25,323,611 (GRCm39) Y605* probably null Het
Trank1 T A 9: 111,196,317 (GRCm39) L1447Q probably damaging Het
Trim56 A G 5: 137,141,446 (GRCm39) L690P probably damaging Het
Trmt13 T C 3: 116,376,417 (GRCm39) T325A probably benign Het
Ttn T A 2: 76,539,811 (GRCm39) T34392S probably benign Het
Uncx A G 5: 139,532,571 (GRCm39) E212G probably damaging Het
Ush2a A G 1: 188,679,281 (GRCm39) T4830A probably benign Het
Usp34 C A 11: 23,362,345 (GRCm39) T1616N Het
Vars1 C T 17: 35,234,953 (GRCm39) L1261F possibly damaging Het
Vmn1r223 T C 13: 23,434,020 (GRCm39) S205P probably damaging Het
Vmn2r118 A T 17: 55,917,423 (GRCm39) I363K possibly damaging Het
Vmn2r69 A T 7: 85,064,838 (GRCm39) M16K probably benign Het
Wdr62 G A 7: 29,962,128 (GRCm39) T428I possibly damaging Het
Yeats4 A T 10: 117,053,374 (GRCm39) L129Q probably benign Het
Zfp423 T C 8: 88,509,784 (GRCm39) R187G probably damaging Het
Zfp853 A T 5: 143,274,702 (GRCm39) L321Q unknown Het
Other mutations in Efs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02176:Efs APN 14 55,158,499 (GRCm39) missense probably damaging 1.00
IGL02720:Efs APN 14 55,157,172 (GRCm39) missense probably damaging 1.00
IGL02752:Efs APN 14 55,154,880 (GRCm39) missense probably damaging 0.96
R0129:Efs UTSW 14 55,154,680 (GRCm39) missense probably damaging 1.00
R1522:Efs UTSW 14 55,157,172 (GRCm39) missense probably damaging 1.00
R1927:Efs UTSW 14 55,154,620 (GRCm39) missense possibly damaging 0.89
R2327:Efs UTSW 14 55,154,961 (GRCm39) missense probably benign 0.01
R3431:Efs UTSW 14 55,157,681 (GRCm39) missense probably damaging 1.00
R3432:Efs UTSW 14 55,157,681 (GRCm39) missense probably damaging 1.00
R3615:Efs UTSW 14 55,157,552 (GRCm39) missense probably damaging 1.00
R3616:Efs UTSW 14 55,157,552 (GRCm39) missense probably damaging 1.00
R3756:Efs UTSW 14 55,157,879 (GRCm39) splice site probably benign
R3945:Efs UTSW 14 55,158,108 (GRCm39) splice site probably benign
R4448:Efs UTSW 14 55,157,649 (GRCm39) missense probably damaging 1.00
R4717:Efs UTSW 14 55,157,801 (GRCm39) missense probably damaging 0.99
R4819:Efs UTSW 14 55,154,610 (GRCm39) missense probably damaging 0.98
R5656:Efs UTSW 14 55,154,584 (GRCm39) missense probably damaging 1.00
R5946:Efs UTSW 14 55,156,951 (GRCm39) splice site probably null
R6054:Efs UTSW 14 55,158,614 (GRCm39) missense probably damaging 1.00
R7457:Efs UTSW 14 55,157,451 (GRCm39) missense probably benign
R7822:Efs UTSW 14 55,154,907 (GRCm39) missense probably benign 0.09
R7970:Efs UTSW 14 55,157,960 (GRCm39) critical splice donor site probably null
R8166:Efs UTSW 14 55,158,077 (GRCm39) missense probably damaging 1.00
R8896:Efs UTSW 14 55,157,756 (GRCm39) missense possibly damaging 0.80
R9438:Efs UTSW 14 55,156,868 (GRCm39) missense
R9703:Efs UTSW 14 55,156,871 (GRCm39) missense possibly damaging 0.88
X0028:Efs UTSW 14 55,158,078 (GRCm39) nonsense probably null
Z1176:Efs UTSW 14 55,157,793 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GCATGTGGTATTCACTCAAGTGG -3'
(R):5'- AGGCTACCATCCACTGAGAG -3'

Sequencing Primer
(F):5'- CTAGTGCTGGAGTCCCAAGCTAC -3'
(R):5'- ATCCACTGAGAGCCTGTCC -3'
Posted On 2020-09-02