Incidental Mutation 'R8347:St3gal1'
ID645329
Institutional Source Beutler Lab
Gene Symbol St3gal1
Ensembl Gene ENSMUSG00000013846
Gene NameST3 beta-galactoside alpha-2,3-sialyltransferase 1
SynonymsSiat4a, CMP-N-acetylneuraminate: [beta-galactosidase alpha-2,3] sialytransferase, ST3GalI, Siat4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R8347 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location67102875-67176830 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 67113662 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 48 (R48C)
Ref Sequence ENSEMBL: ENSMUSP00000090307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092640] [ENSMUST00000229028] [ENSMUST00000229213]
Predicted Effect probably damaging
Transcript: ENSMUST00000092640
AA Change: R48C

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090307
Gene: ENSMUSG00000013846
AA Change: R48C

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Glyco_transf_29 80 336 1.7e-74 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000229028
AA Change: R48C

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000229213
AA Change: R48C

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to galactose-containing substrates. The encoded protein is normally found in the Golgi but can be proteolytically processed to a soluble form. Correct glycosylation of the encoded protein may be critical to its sialyltransferase activity. This protein, which is a member of glycosyltransferase family 29, can use the same acceptor substrates as does sialyltransferase 4B. Two transcript variants encoding the same protein have been found for this gene. Other transcript variants may exist, but have not been fully characterized yet. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in altered terminal glycosylation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T A 13: 59,742,236 D590V possibly damaging Het
1700123K08Rik T A 5: 138,562,891 I170L probably benign Het
Adamts15 C T 9: 30,902,550 R773Q probably benign Het
Ankib1 A G 5: 3,747,065 L249P probably damaging Het
Cabin1 A G 10: 75,742,367 F499L probably damaging Het
Clec12b C T 6: 129,380,487 probably null Het
Col23a1 G A 11: 51,571,256 G373D probably damaging Het
Cse1l C T 2: 166,927,585 T304I possibly damaging Het
D6Wsu163e T A 6: 126,955,288 L330* probably null Het
Dbi A C 1: 120,120,820 L32R possibly damaging Het
Dennd2c A G 3: 103,157,709 Y716C probably damaging Het
Dnah5 G A 15: 28,236,666 M379I possibly damaging Het
Dpys T C 15: 39,857,313 D17G probably benign Het
Dync2h1 C T 9: 7,116,578 S2319N possibly damaging Het
Dyrk2 T C 10: 118,859,983 K457E probably damaging Het
Efs A G 14: 54,919,784 C357R probably benign Het
Egfr T A 11: 16,878,174 W516R probably damaging Het
Folh1 T A 7: 86,729,118 R529* probably null Het
Fsip2 A C 2: 82,987,854 I4644L probably benign Het
Garnl3 T C 2: 33,085,891 Y66C probably damaging Het
Gli3 T C 13: 15,723,525 L730P probably damaging Het
Gm19668 T C 10: 77,798,387 *249W probably null Het
Gm28710 G A 5: 16,801,574 M96I probably benign Het
Ighv2-6-8 T C 12: 113,796,327 D54G probably benign Het
Irs2 C A 8: 11,008,000 S144I possibly damaging Het
Itgb5 T C 16: 33,940,678 C628R probably damaging Het
Kcnh4 A T 11: 100,757,749 V43D probably damaging Het
Krtap16-3 A T 16: 88,962,619 Y69N unknown Het
Lcn12 A C 2: 25,492,033 D176E possibly damaging Het
Lilr4b T A 10: 51,481,754 F181L probably damaging Het
Med13l T A 5: 118,742,597 H1251Q probably benign Het
Nppb C A 4: 147,986,299 L44M probably damaging Het
Nutm2 T C 13: 50,472,337 V320A probably benign Het
Olfr1272 A T 2: 90,281,676 W300R probably benign Het
Olfr291 C T 7: 84,856,755 P131S probably damaging Het
Olfr628 A G 7: 103,731,943 S6G probably benign Het
Olfr987 T A 2: 85,331,703 H65L probably damaging Het
Padi6 T C 4: 140,735,408 M301V probably benign Het
Pappa G A 4: 65,327,065 R1530Q probably damaging Het
Pcgf6 C T 19: 47,045,838 D255N possibly damaging Het
Pgap3 TCAGCAGCAGCAGCAGCAG TCAGCAGCAGCAGCAG 11: 98,390,749 probably benign Het
Phip A G 9: 82,908,763 I710T probably benign Het
Pla2r1 A T 2: 60,534,903 Y108N probably damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Rint1 C G 5: 23,811,772 L512V probably damaging Het
Sdad1 A C 5: 92,298,229 F282L probably benign Het
Sirt5 G T 13: 43,380,501 A189S probably benign Het
Slc14a1 T C 18: 78,111,431 T247A probably benign Het
Slc22a6 C G 19: 8,621,805 R267G probably damaging Het
Slfn3 A G 11: 83,213,589 K429E possibly damaging Het
Spag17 T C 3: 100,027,641 F721S probably benign Het
Sult2a6 A G 7: 14,225,958 Y217H probably benign Het
Synj2 A G 17: 6,009,785 N394S probably damaging Het
Telo2 A T 17: 25,104,637 Y605* probably null Het
Trank1 T A 9: 111,367,249 L1447Q probably damaging Het
Trim56 A G 5: 137,112,592 L690P probably damaging Het
Trmt13 T C 3: 116,582,768 T325A probably benign Het
Ttn T A 2: 76,709,467 T34392S probably benign Het
Uncx A G 5: 139,546,816 E212G probably damaging Het
Ush2a A G 1: 188,947,084 T4830A probably benign Het
Usp34 C A 11: 23,412,345 T1616N Het
Vars C T 17: 35,015,977 L1261F possibly damaging Het
Vmn1r223 T C 13: 23,249,850 S205P probably damaging Het
Vmn2r118 A T 17: 55,610,423 I363K possibly damaging Het
Vmn2r69 A T 7: 85,415,630 M16K probably benign Het
Wdr62 G A 7: 30,262,703 T428I possibly damaging Het
Yeats4 A T 10: 117,217,469 L129Q probably benign Het
Zfp423 T C 8: 87,783,156 R187G probably damaging Het
Zfp853 A T 5: 143,288,947 L321Q unknown Het
Other mutations in St3gal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01528:St3gal1 APN 15 67112617 missense probably benign 0.03
Benelux UTSW 15 67113785 nonsense probably null
Luxembourg UTSW 15 67111346 missense possibly damaging 0.52
Monaco UTSW 15 67113662 missense probably damaging 0.99
Strasbourg UTSW 15 67106673 missense probably damaging 0.99
R0452:St3gal1 UTSW 15 67109655 splice site probably benign
R0478:St3gal1 UTSW 15 67113730 missense probably damaging 1.00
R0735:St3gal1 UTSW 15 67113687 missense probably benign
R2357:St3gal1 UTSW 15 67113782 missense probably benign 0.01
R5061:St3gal1 UTSW 15 67108229 missense probably benign 0.40
R5199:St3gal1 UTSW 15 67113715 missense probably benign 0.00
R5734:St3gal1 UTSW 15 67106673 missense probably damaging 0.99
R5828:St3gal1 UTSW 15 67113785 nonsense probably null
R6370:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6371:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6373:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6385:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6387:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6388:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6417:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6420:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6421:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6462:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6463:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6469:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6473:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6474:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6759:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6760:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6894:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6963:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R7250:St3gal1 UTSW 15 67106729 missense possibly damaging 0.89
R7394:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R7588:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R7590:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R7591:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R7860:St3gal1 UTSW 15 67111265 missense probably benign 0.38
R7954:St3gal1 UTSW 15 67112573 missense probably damaging 1.00
R8346:St3gal1 UTSW 15 67113662 missense probably damaging 0.99
R8348:St3gal1 UTSW 15 67113662 missense probably damaging 0.99
R8895:St3gal1 UTSW 15 67108237 missense possibly damaging 0.87
Z1177:St3gal1 UTSW 15 67111367 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AGACCCTATTCTGCTCACCAG -3'
(R):5'- AGCTGCTTCTGAGATCTCCC -3'

Sequencing Primer
(F):5'- AGCCACCACCGGTATGTGTC -3'
(R):5'- TCTGAGATCTCCCTGCGGAC -3'
Posted On2020-09-02