Incidental Mutation 'R8347:Vmn2r118'
ID645335
Institutional Source Beutler Lab
Gene Symbol Vmn2r118
Ensembl Gene ENSMUSG00000091504
Gene Namevomeronasal 2, receptor 118
SynonymsEG383258, Vmn2r119, EG668547
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R8347 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location55592341-55624672 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55610423 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 363 (I363K)
Ref Sequence ENSEMBL: ENSMUSP00000131128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168440]
Predicted Effect possibly damaging
Transcript: ENSMUST00000168440
AA Change: I363K

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131128
Gene: ENSMUSG00000091504
AA Change: I363K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 142 470 4.6e-27 PFAM
Pfam:NCD3G 513 566 2.6e-20 PFAM
Pfam:7tm_3 599 834 5.9e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T A 13: 59,742,236 D590V possibly damaging Het
1700123K08Rik T A 5: 138,562,891 I170L probably benign Het
Adamts15 C T 9: 30,902,550 R773Q probably benign Het
Ankib1 A G 5: 3,747,065 L249P probably damaging Het
Cabin1 A G 10: 75,742,367 F499L probably damaging Het
Clec12b C T 6: 129,380,487 probably null Het
Col23a1 G A 11: 51,571,256 G373D probably damaging Het
Cse1l C T 2: 166,927,585 T304I possibly damaging Het
D6Wsu163e T A 6: 126,955,288 L330* probably null Het
Dbi A C 1: 120,120,820 L32R possibly damaging Het
Dennd2c A G 3: 103,157,709 Y716C probably damaging Het
Dnah5 G A 15: 28,236,666 M379I possibly damaging Het
Dpys T C 15: 39,857,313 D17G probably benign Het
Dync2h1 C T 9: 7,116,578 S2319N possibly damaging Het
Dyrk2 T C 10: 118,859,983 K457E probably damaging Het
Efs A G 14: 54,919,784 C357R probably benign Het
Egfr T A 11: 16,878,174 W516R probably damaging Het
Folh1 T A 7: 86,729,118 R529* probably null Het
Fsip2 A C 2: 82,987,854 I4644L probably benign Het
Garnl3 T C 2: 33,085,891 Y66C probably damaging Het
Gli3 T C 13: 15,723,525 L730P probably damaging Het
Gm19668 T C 10: 77,798,387 *249W probably null Het
Gm28710 G A 5: 16,801,574 M96I probably benign Het
Ighv2-6-8 T C 12: 113,796,327 D54G probably benign Het
Irs2 C A 8: 11,008,000 S144I possibly damaging Het
Itgb5 T C 16: 33,940,678 C628R probably damaging Het
Kcnh4 A T 11: 100,757,749 V43D probably damaging Het
Krtap16-3 A T 16: 88,962,619 Y69N unknown Het
Lcn12 A C 2: 25,492,033 D176E possibly damaging Het
Lilr4b T A 10: 51,481,754 F181L probably damaging Het
Med13l T A 5: 118,742,597 H1251Q probably benign Het
Nppb C A 4: 147,986,299 L44M probably damaging Het
Nutm2 T C 13: 50,472,337 V320A probably benign Het
Olfr1272 A T 2: 90,281,676 W300R probably benign Het
Olfr291 C T 7: 84,856,755 P131S probably damaging Het
Olfr628 A G 7: 103,731,943 S6G probably benign Het
Olfr987 T A 2: 85,331,703 H65L probably damaging Het
Padi6 T C 4: 140,735,408 M301V probably benign Het
Pappa G A 4: 65,327,065 R1530Q probably damaging Het
Pcgf6 C T 19: 47,045,838 D255N possibly damaging Het
Pgap3 TCAGCAGCAGCAGCAGCAG TCAGCAGCAGCAGCAG 11: 98,390,749 probably benign Het
Phip A G 9: 82,908,763 I710T probably benign Het
Pla2r1 A T 2: 60,534,903 Y108N probably damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Rint1 C G 5: 23,811,772 L512V probably damaging Het
Sdad1 A C 5: 92,298,229 F282L probably benign Het
Sirt5 G T 13: 43,380,501 A189S probably benign Het
Slc14a1 T C 18: 78,111,431 T247A probably benign Het
Slc22a6 C G 19: 8,621,805 R267G probably damaging Het
Slfn3 A G 11: 83,213,589 K429E possibly damaging Het
Spag17 T C 3: 100,027,641 F721S probably benign Het
St3gal1 G A 15: 67,113,662 R48C probably damaging Het
Sult2a6 A G 7: 14,225,958 Y217H probably benign Het
Synj2 A G 17: 6,009,785 N394S probably damaging Het
Telo2 A T 17: 25,104,637 Y605* probably null Het
Trank1 T A 9: 111,367,249 L1447Q probably damaging Het
Trim56 A G 5: 137,112,592 L690P probably damaging Het
Trmt13 T C 3: 116,582,768 T325A probably benign Het
Ttn T A 2: 76,709,467 T34392S probably benign Het
Uncx A G 5: 139,546,816 E212G probably damaging Het
Ush2a A G 1: 188,947,084 T4830A probably benign Het
Usp34 C A 11: 23,412,345 T1616N Het
Vars C T 17: 35,015,977 L1261F possibly damaging Het
Vmn1r223 T C 13: 23,249,850 S205P probably damaging Het
Vmn2r69 A T 7: 85,415,630 M16K probably benign Het
Wdr62 G A 7: 30,262,703 T428I possibly damaging Het
Yeats4 A T 10: 117,217,469 L129Q probably benign Het
Zfp423 T C 8: 87,783,156 R187G probably damaging Het
Zfp853 A T 5: 143,288,947 L321Q unknown Het
Other mutations in Vmn2r118
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Vmn2r118 APN 17 55592708 missense probably damaging 1.00
IGL00976:Vmn2r118 APN 17 55593204 missense probably damaging 1.00
IGL01419:Vmn2r118 APN 17 55593000 missense probably benign 0.01
IGL01796:Vmn2r118 APN 17 55608585 missense probably benign 0.30
IGL01799:Vmn2r118 APN 17 55592990 missense probably damaging 1.00
IGL02002:Vmn2r118 APN 17 55592619 missense probably damaging 1.00
IGL02075:Vmn2r118 APN 17 55610517 missense probably benign 0.18
IGL02172:Vmn2r118 APN 17 55624598 missense probably benign 0.00
IGL02529:Vmn2r118 APN 17 55610870 missense possibly damaging 0.58
IGL02712:Vmn2r118 APN 17 55592655 missense probably benign 0.21
IGL03096:Vmn2r118 APN 17 55607996 missense probably damaging 1.00
R0306:Vmn2r118 UTSW 17 55608616 missense possibly damaging 0.89
R0329:Vmn2r118 UTSW 17 55610717 missense probably damaging 1.00
R0330:Vmn2r118 UTSW 17 55610717 missense probably damaging 1.00
R0396:Vmn2r118 UTSW 17 55608643 missense probably benign 0.00
R0411:Vmn2r118 UTSW 17 55611021 splice site probably benign
R0513:Vmn2r118 UTSW 17 55610970 nonsense probably null
R0627:Vmn2r118 UTSW 17 55610772 missense probably benign 0.01
R0638:Vmn2r118 UTSW 17 55608466 missense probably benign 0.03
R1328:Vmn2r118 UTSW 17 55608620 missense probably benign 0.01
R1366:Vmn2r118 UTSW 17 55593237 nonsense probably null
R1465:Vmn2r118 UTSW 17 55610935 missense probably benign 0.33
R1465:Vmn2r118 UTSW 17 55610935 missense probably benign 0.33
R1511:Vmn2r118 UTSW 17 55608496 nonsense probably null
R1515:Vmn2r118 UTSW 17 55610643 missense probably benign 0.25
R1550:Vmn2r118 UTSW 17 55608083 missense probably damaging 1.00
R1779:Vmn2r118 UTSW 17 55611530 missense probably benign 0.03
R1834:Vmn2r118 UTSW 17 55592456 missense probably damaging 1.00
R1840:Vmn2r118 UTSW 17 55610406 nonsense probably null
R1854:Vmn2r118 UTSW 17 55611556 missense possibly damaging 0.57
R1967:Vmn2r118 UTSW 17 55592882 missense probably damaging 1.00
R1976:Vmn2r118 UTSW 17 55592925 missense probably damaging 1.00
R2308:Vmn2r118 UTSW 17 55624650 missense probably benign 0.33
R3700:Vmn2r118 UTSW 17 55608421 missense possibly damaging 0.68
R4334:Vmn2r118 UTSW 17 55610347 missense possibly damaging 0.58
R4647:Vmn2r118 UTSW 17 55610665 missense probably damaging 1.00
R4709:Vmn2r118 UTSW 17 55610860 missense probably damaging 1.00
R4805:Vmn2r118 UTSW 17 55592581 missense probably damaging 1.00
R4858:Vmn2r118 UTSW 17 55592894 missense probably damaging 0.98
R5384:Vmn2r118 UTSW 17 55611565 missense probably benign 0.00
R5385:Vmn2r118 UTSW 17 55611565 missense probably benign 0.00
R5664:Vmn2r118 UTSW 17 55592765 missense possibly damaging 0.46
R5740:Vmn2r118 UTSW 17 55593103 missense probably benign 0.00
R5927:Vmn2r118 UTSW 17 55624494 missense probably benign 0.04
R6143:Vmn2r118 UTSW 17 55592871 missense possibly damaging 0.92
R6513:Vmn2r118 UTSW 17 55608093 missense probably damaging 1.00
R6573:Vmn2r118 UTSW 17 55592996 missense probably damaging 1.00
R6760:Vmn2r118 UTSW 17 55592714 missense possibly damaging 0.92
R6794:Vmn2r118 UTSW 17 55592348 missense possibly damaging 0.48
R6929:Vmn2r118 UTSW 17 55610440 missense probably benign 0.01
R7201:Vmn2r118 UTSW 17 55608496 nonsense probably null
R7539:Vmn2r118 UTSW 17 55592853 missense probably damaging 0.98
R7836:Vmn2r118 UTSW 17 55593242 missense probably damaging 0.99
R8179:Vmn2r118 UTSW 17 55608484 missense probably benign 0.36
R8248:Vmn2r118 UTSW 17 55610936 missense probably benign 0.18
R8415:Vmn2r118 UTSW 17 55608057 missense probably benign 0.08
R8428:Vmn2r118 UTSW 17 55608642 missense probably benign 0.33
R8917:Vmn2r118 UTSW 17 55610216 missense possibly damaging 0.82
R8993:Vmn2r118 UTSW 17 55610835 missense possibly damaging 0.72
X0022:Vmn2r118 UTSW 17 55593218 missense probably damaging 1.00
Z1176:Vmn2r118 UTSW 17 55610655 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACGCACTCCTGCATTAGTTG -3'
(R):5'- TCACAATGGGATGCCATCAC -3'

Sequencing Primer
(F):5'- CATTAGTTGGGTCACATTTTCCAG -3'
(R):5'- CAAGGGAGAAAGACTTCAGCCTTAC -3'
Posted On2020-09-02