Incidental Mutation 'R8347:Vmn2r118'
ID 645335
Institutional Source Beutler Lab
Gene Symbol Vmn2r118
Ensembl Gene ENSMUSG00000091504
Gene Name vomeronasal 2, receptor 118
Synonyms Vmn2r119, EG668547, EG383258
MMRRC Submission 067867-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.128) question?
Stock # R8347 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 55899341-55931672 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 55917423 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 363 (I363K)
Ref Sequence ENSEMBL: ENSMUSP00000131128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168440]
AlphaFold E9Q1C1
Predicted Effect possibly damaging
Transcript: ENSMUST00000168440
AA Change: I363K

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131128
Gene: ENSMUSG00000091504
AA Change: I363K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 142 470 4.6e-27 PFAM
Pfam:NCD3G 513 566 2.6e-20 PFAM
Pfam:7tm_3 599 834 5.9e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik T A 5: 138,561,153 (GRCm39) I170L probably benign Het
Adamts15 C T 9: 30,813,846 (GRCm39) R773Q probably benign Het
Ankib1 A G 5: 3,797,065 (GRCm39) L249P probably damaging Het
Cabin1 A G 10: 75,578,201 (GRCm39) F499L probably damaging Het
Cdhr17 G A 5: 17,006,572 (GRCm39) M96I probably benign Het
Clec12b C T 6: 129,357,450 (GRCm39) probably null Het
Col23a1 G A 11: 51,462,083 (GRCm39) G373D probably damaging Het
Cse1l C T 2: 166,769,505 (GRCm39) T304I possibly damaging Het
D6Wsu163e T A 6: 126,932,251 (GRCm39) L330* probably null Het
Dbi A C 1: 120,048,550 (GRCm39) L32R possibly damaging Het
Dennd2c A G 3: 103,065,025 (GRCm39) Y716C probably damaging Het
Dnah5 G A 15: 28,236,812 (GRCm39) M379I possibly damaging Het
Dpys T C 15: 39,720,709 (GRCm39) D17G probably benign Het
Dync2h1 C T 9: 7,116,578 (GRCm39) S2319N possibly damaging Het
Dyrk2 T C 10: 118,695,888 (GRCm39) K457E probably damaging Het
Efs A G 14: 55,157,241 (GRCm39) C357R probably benign Het
Egfr T A 11: 16,828,174 (GRCm39) W516R probably damaging Het
Folh1 T A 7: 86,378,326 (GRCm39) R529* probably null Het
Fsip2 A C 2: 82,818,198 (GRCm39) I4644L probably benign Het
Garnl3 T C 2: 32,975,903 (GRCm39) Y66C probably damaging Het
Gli3 T C 13: 15,898,110 (GRCm39) L730P probably damaging Het
Gm19668 T C 10: 77,634,221 (GRCm39) *249W probably null Het
Ighv2-6-8 T C 12: 113,759,947 (GRCm39) D54G probably benign Het
Irs2 C A 8: 11,058,000 (GRCm39) S144I possibly damaging Het
Itgb5 T C 16: 33,761,048 (GRCm39) C628R probably damaging Het
Kcnh4 A T 11: 100,648,575 (GRCm39) V43D probably damaging Het
Krtap16-3 A T 16: 88,759,507 (GRCm39) Y69N unknown Het
Lcn12 A C 2: 25,382,045 (GRCm39) D176E possibly damaging Het
Lilrb4b T A 10: 51,357,850 (GRCm39) F181L probably damaging Het
Med13l T A 5: 118,880,662 (GRCm39) H1251Q probably benign Het
Nppb C A 4: 148,070,756 (GRCm39) L44M probably damaging Het
Nutm2 T C 13: 50,626,373 (GRCm39) V320A probably benign Het
Or4b1b A T 2: 90,112,020 (GRCm39) W300R probably benign Het
Or52a24 A G 7: 103,381,150 (GRCm39) S6G probably benign Het
Or5ae2 C T 7: 84,505,963 (GRCm39) P131S probably damaging Het
Or5ak4 T A 2: 85,162,047 (GRCm39) H65L probably damaging Het
Padi6 T C 4: 140,462,719 (GRCm39) M301V probably benign Het
Pappa G A 4: 65,245,302 (GRCm39) R1530Q probably damaging Het
Pcgf6 C T 19: 47,034,277 (GRCm39) D255N possibly damaging Het
Pgap3 TCAGCAGCAGCAGCAGCAG TCAGCAGCAGCAGCAG 11: 98,281,575 (GRCm39) probably benign Het
Phip A G 9: 82,790,816 (GRCm39) I710T probably benign Het
Pla2r1 A T 2: 60,365,247 (GRCm39) Y108N probably damaging Het
Plat G T 8: 23,262,248 (GRCm39) G91W probably damaging Het
Rint1 C G 5: 24,016,770 (GRCm39) L512V probably damaging Het
Sdad1 A C 5: 92,446,088 (GRCm39) F282L probably benign Het
Sirt5 G T 13: 43,533,977 (GRCm39) A189S probably benign Het
Slc14a1 T C 18: 78,154,646 (GRCm39) T247A probably benign Het
Slc22a6 C G 19: 8,599,169 (GRCm39) R267G probably damaging Het
Slfn3 A G 11: 83,104,415 (GRCm39) K429E possibly damaging Het
Spag17 T C 3: 99,934,957 (GRCm39) F721S probably benign Het
Spata31d1e T A 13: 59,890,050 (GRCm39) D590V possibly damaging Het
St3gal1 G A 15: 66,985,511 (GRCm39) R48C probably damaging Het
Sult2a6 A G 7: 13,959,883 (GRCm39) Y217H probably benign Het
Synj2 A G 17: 6,060,060 (GRCm39) N394S probably damaging Het
Telo2 A T 17: 25,323,611 (GRCm39) Y605* probably null Het
Trank1 T A 9: 111,196,317 (GRCm39) L1447Q probably damaging Het
Trim56 A G 5: 137,141,446 (GRCm39) L690P probably damaging Het
Trmt13 T C 3: 116,376,417 (GRCm39) T325A probably benign Het
Ttn T A 2: 76,539,811 (GRCm39) T34392S probably benign Het
Uncx A G 5: 139,532,571 (GRCm39) E212G probably damaging Het
Ush2a A G 1: 188,679,281 (GRCm39) T4830A probably benign Het
Usp34 C A 11: 23,362,345 (GRCm39) T1616N Het
Vars1 C T 17: 35,234,953 (GRCm39) L1261F possibly damaging Het
Vmn1r223 T C 13: 23,434,020 (GRCm39) S205P probably damaging Het
Vmn2r69 A T 7: 85,064,838 (GRCm39) M16K probably benign Het
Wdr62 G A 7: 29,962,128 (GRCm39) T428I possibly damaging Het
Yeats4 A T 10: 117,053,374 (GRCm39) L129Q probably benign Het
Zfp423 T C 8: 88,509,784 (GRCm39) R187G probably damaging Het
Zfp853 A T 5: 143,274,702 (GRCm39) L321Q unknown Het
Other mutations in Vmn2r118
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Vmn2r118 APN 17 55,899,708 (GRCm39) missense probably damaging 1.00
IGL00976:Vmn2r118 APN 17 55,900,204 (GRCm39) missense probably damaging 1.00
IGL01419:Vmn2r118 APN 17 55,900,000 (GRCm39) missense probably benign 0.01
IGL01796:Vmn2r118 APN 17 55,915,585 (GRCm39) missense probably benign 0.30
IGL01799:Vmn2r118 APN 17 55,899,990 (GRCm39) missense probably damaging 1.00
IGL02002:Vmn2r118 APN 17 55,899,619 (GRCm39) missense probably damaging 1.00
IGL02075:Vmn2r118 APN 17 55,917,517 (GRCm39) missense probably benign 0.18
IGL02172:Vmn2r118 APN 17 55,931,598 (GRCm39) missense probably benign 0.00
IGL02529:Vmn2r118 APN 17 55,917,870 (GRCm39) missense possibly damaging 0.58
IGL02712:Vmn2r118 APN 17 55,899,655 (GRCm39) missense probably benign 0.21
IGL03096:Vmn2r118 APN 17 55,914,996 (GRCm39) missense probably damaging 1.00
R0306:Vmn2r118 UTSW 17 55,915,616 (GRCm39) missense possibly damaging 0.89
R0329:Vmn2r118 UTSW 17 55,917,717 (GRCm39) missense probably damaging 1.00
R0330:Vmn2r118 UTSW 17 55,917,717 (GRCm39) missense probably damaging 1.00
R0396:Vmn2r118 UTSW 17 55,915,643 (GRCm39) missense probably benign 0.00
R0411:Vmn2r118 UTSW 17 55,918,021 (GRCm39) splice site probably benign
R0513:Vmn2r118 UTSW 17 55,917,970 (GRCm39) nonsense probably null
R0627:Vmn2r118 UTSW 17 55,917,772 (GRCm39) missense probably benign 0.01
R0638:Vmn2r118 UTSW 17 55,915,466 (GRCm39) missense probably benign 0.03
R1328:Vmn2r118 UTSW 17 55,915,620 (GRCm39) missense probably benign 0.01
R1366:Vmn2r118 UTSW 17 55,900,237 (GRCm39) nonsense probably null
R1465:Vmn2r118 UTSW 17 55,917,935 (GRCm39) missense probably benign 0.33
R1465:Vmn2r118 UTSW 17 55,917,935 (GRCm39) missense probably benign 0.33
R1511:Vmn2r118 UTSW 17 55,915,496 (GRCm39) nonsense probably null
R1515:Vmn2r118 UTSW 17 55,917,643 (GRCm39) missense probably benign 0.25
R1550:Vmn2r118 UTSW 17 55,915,083 (GRCm39) missense probably damaging 1.00
R1779:Vmn2r118 UTSW 17 55,918,530 (GRCm39) missense probably benign 0.03
R1834:Vmn2r118 UTSW 17 55,899,456 (GRCm39) missense probably damaging 1.00
R1840:Vmn2r118 UTSW 17 55,917,406 (GRCm39) nonsense probably null
R1854:Vmn2r118 UTSW 17 55,918,556 (GRCm39) missense possibly damaging 0.57
R1967:Vmn2r118 UTSW 17 55,899,882 (GRCm39) missense probably damaging 1.00
R1976:Vmn2r118 UTSW 17 55,899,925 (GRCm39) missense probably damaging 1.00
R2308:Vmn2r118 UTSW 17 55,931,650 (GRCm39) missense probably benign 0.33
R3700:Vmn2r118 UTSW 17 55,915,421 (GRCm39) missense possibly damaging 0.68
R4334:Vmn2r118 UTSW 17 55,917,347 (GRCm39) missense possibly damaging 0.58
R4647:Vmn2r118 UTSW 17 55,917,665 (GRCm39) missense probably damaging 1.00
R4709:Vmn2r118 UTSW 17 55,917,860 (GRCm39) missense probably damaging 1.00
R4805:Vmn2r118 UTSW 17 55,899,581 (GRCm39) missense probably damaging 1.00
R4858:Vmn2r118 UTSW 17 55,899,894 (GRCm39) missense probably damaging 0.98
R5384:Vmn2r118 UTSW 17 55,918,565 (GRCm39) missense probably benign 0.00
R5385:Vmn2r118 UTSW 17 55,918,565 (GRCm39) missense probably benign 0.00
R5664:Vmn2r118 UTSW 17 55,899,765 (GRCm39) missense possibly damaging 0.46
R5740:Vmn2r118 UTSW 17 55,900,103 (GRCm39) missense probably benign 0.00
R5927:Vmn2r118 UTSW 17 55,931,494 (GRCm39) missense probably benign 0.04
R6143:Vmn2r118 UTSW 17 55,899,871 (GRCm39) missense possibly damaging 0.92
R6513:Vmn2r118 UTSW 17 55,915,093 (GRCm39) missense probably damaging 1.00
R6573:Vmn2r118 UTSW 17 55,899,996 (GRCm39) missense probably damaging 1.00
R6760:Vmn2r118 UTSW 17 55,899,714 (GRCm39) missense possibly damaging 0.92
R6794:Vmn2r118 UTSW 17 55,899,348 (GRCm39) missense possibly damaging 0.48
R6929:Vmn2r118 UTSW 17 55,917,440 (GRCm39) missense probably benign 0.01
R7201:Vmn2r118 UTSW 17 55,915,496 (GRCm39) nonsense probably null
R7539:Vmn2r118 UTSW 17 55,899,853 (GRCm39) missense probably damaging 0.98
R7836:Vmn2r118 UTSW 17 55,900,242 (GRCm39) missense probably damaging 0.99
R8179:Vmn2r118 UTSW 17 55,915,484 (GRCm39) missense probably benign 0.36
R8248:Vmn2r118 UTSW 17 55,917,936 (GRCm39) missense probably benign 0.18
R8415:Vmn2r118 UTSW 17 55,915,057 (GRCm39) missense probably benign 0.08
R8428:Vmn2r118 UTSW 17 55,915,642 (GRCm39) missense probably benign 0.33
R8917:Vmn2r118 UTSW 17 55,917,216 (GRCm39) missense possibly damaging 0.82
R8993:Vmn2r118 UTSW 17 55,917,835 (GRCm39) missense possibly damaging 0.72
R9038:Vmn2r118 UTSW 17 55,918,649 (GRCm39) missense probably damaging 1.00
R9155:Vmn2r118 UTSW 17 55,917,207 (GRCm39) missense probably null 0.83
R9603:Vmn2r118 UTSW 17 55,899,837 (GRCm39) missense probably damaging 1.00
R9742:Vmn2r118 UTSW 17 55,918,009 (GRCm39) missense probably damaging 0.98
R9749:Vmn2r118 UTSW 17 55,915,415 (GRCm39) critical splice donor site probably null
R9792:Vmn2r118 UTSW 17 55,899,496 (GRCm39) missense probably damaging 0.99
R9793:Vmn2r118 UTSW 17 55,899,496 (GRCm39) missense probably damaging 0.99
R9795:Vmn2r118 UTSW 17 55,899,496 (GRCm39) missense probably damaging 0.99
X0022:Vmn2r118 UTSW 17 55,900,218 (GRCm39) missense probably damaging 1.00
Z1176:Vmn2r118 UTSW 17 55,917,655 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACGCACTCCTGCATTAGTTG -3'
(R):5'- TCACAATGGGATGCCATCAC -3'

Sequencing Primer
(F):5'- CATTAGTTGGGTCACATTTTCCAG -3'
(R):5'- CAAGGGAGAAAGACTTCAGCCTTAC -3'
Posted On 2020-09-02