Incidental Mutation 'R8347:Slc22a6'
ID 645337
Institutional Source Beutler Lab
Gene Symbol Slc22a6
Ensembl Gene ENSMUSG00000024650
Gene Name solute carrier family 22 (organic anion transporter), member 6
Synonyms mOat1, Orctl1, NKT, Oat1
MMRRC Submission 067867-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R8347 (G1)
Quality Score 224.009
Status Not validated
Chromosome 19
Chromosomal Location 8595403-8605663 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 8599169 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 267 (R267G)
Ref Sequence ENSEMBL: ENSMUSP00000010250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010250]
AlphaFold Q8VC69
Predicted Effect probably damaging
Transcript: ENSMUST00000010250
AA Change: R267G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000010250
Gene: ENSMUSG00000024650
AA Change: R267G

DomainStartEndE-ValueType
Pfam:MFS_1 107 467 2.4e-25 PFAM
Pfam:Sugar_tr 107 512 8e-33 PFAM
low complexity region 520 531 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the sodium-dependent transport and excretion of organic anions, some of which are potentially toxic. The encoded protein is an integral membrane protein and may be localized to the basolateral membrane. Four transcript variants encoding four different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene may result in increased thymus weight or impaired renal organic anion excretion for a subset of organic anions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik T A 5: 138,561,153 (GRCm39) I170L probably benign Het
Adamts15 C T 9: 30,813,846 (GRCm39) R773Q probably benign Het
Ankib1 A G 5: 3,797,065 (GRCm39) L249P probably damaging Het
Cabin1 A G 10: 75,578,201 (GRCm39) F499L probably damaging Het
Cdhr17 G A 5: 17,006,572 (GRCm39) M96I probably benign Het
Clec12b C T 6: 129,357,450 (GRCm39) probably null Het
Col23a1 G A 11: 51,462,083 (GRCm39) G373D probably damaging Het
Cse1l C T 2: 166,769,505 (GRCm39) T304I possibly damaging Het
D6Wsu163e T A 6: 126,932,251 (GRCm39) L330* probably null Het
Dbi A C 1: 120,048,550 (GRCm39) L32R possibly damaging Het
Dennd2c A G 3: 103,065,025 (GRCm39) Y716C probably damaging Het
Dnah5 G A 15: 28,236,812 (GRCm39) M379I possibly damaging Het
Dpys T C 15: 39,720,709 (GRCm39) D17G probably benign Het
Dync2h1 C T 9: 7,116,578 (GRCm39) S2319N possibly damaging Het
Dyrk2 T C 10: 118,695,888 (GRCm39) K457E probably damaging Het
Efs A G 14: 55,157,241 (GRCm39) C357R probably benign Het
Egfr T A 11: 16,828,174 (GRCm39) W516R probably damaging Het
Folh1 T A 7: 86,378,326 (GRCm39) R529* probably null Het
Fsip2 A C 2: 82,818,198 (GRCm39) I4644L probably benign Het
Garnl3 T C 2: 32,975,903 (GRCm39) Y66C probably damaging Het
Gli3 T C 13: 15,898,110 (GRCm39) L730P probably damaging Het
Gm19668 T C 10: 77,634,221 (GRCm39) *249W probably null Het
Ighv2-6-8 T C 12: 113,759,947 (GRCm39) D54G probably benign Het
Irs2 C A 8: 11,058,000 (GRCm39) S144I possibly damaging Het
Itgb5 T C 16: 33,761,048 (GRCm39) C628R probably damaging Het
Kcnh4 A T 11: 100,648,575 (GRCm39) V43D probably damaging Het
Krtap16-3 A T 16: 88,759,507 (GRCm39) Y69N unknown Het
Lcn12 A C 2: 25,382,045 (GRCm39) D176E possibly damaging Het
Lilrb4b T A 10: 51,357,850 (GRCm39) F181L probably damaging Het
Med13l T A 5: 118,880,662 (GRCm39) H1251Q probably benign Het
Nppb C A 4: 148,070,756 (GRCm39) L44M probably damaging Het
Nutm2 T C 13: 50,626,373 (GRCm39) V320A probably benign Het
Or4b1b A T 2: 90,112,020 (GRCm39) W300R probably benign Het
Or52a24 A G 7: 103,381,150 (GRCm39) S6G probably benign Het
Or5ae2 C T 7: 84,505,963 (GRCm39) P131S probably damaging Het
Or5ak4 T A 2: 85,162,047 (GRCm39) H65L probably damaging Het
Padi6 T C 4: 140,462,719 (GRCm39) M301V probably benign Het
Pappa G A 4: 65,245,302 (GRCm39) R1530Q probably damaging Het
Pcgf6 C T 19: 47,034,277 (GRCm39) D255N possibly damaging Het
Pgap3 TCAGCAGCAGCAGCAGCAG TCAGCAGCAGCAGCAG 11: 98,281,575 (GRCm39) probably benign Het
Phip A G 9: 82,790,816 (GRCm39) I710T probably benign Het
Pla2r1 A T 2: 60,365,247 (GRCm39) Y108N probably damaging Het
Plat G T 8: 23,262,248 (GRCm39) G91W probably damaging Het
Rint1 C G 5: 24,016,770 (GRCm39) L512V probably damaging Het
Sdad1 A C 5: 92,446,088 (GRCm39) F282L probably benign Het
Sirt5 G T 13: 43,533,977 (GRCm39) A189S probably benign Het
Slc14a1 T C 18: 78,154,646 (GRCm39) T247A probably benign Het
Slfn3 A G 11: 83,104,415 (GRCm39) K429E possibly damaging Het
Spag17 T C 3: 99,934,957 (GRCm39) F721S probably benign Het
Spata31d1e T A 13: 59,890,050 (GRCm39) D590V possibly damaging Het
St3gal1 G A 15: 66,985,511 (GRCm39) R48C probably damaging Het
Sult2a6 A G 7: 13,959,883 (GRCm39) Y217H probably benign Het
Synj2 A G 17: 6,060,060 (GRCm39) N394S probably damaging Het
Telo2 A T 17: 25,323,611 (GRCm39) Y605* probably null Het
Trank1 T A 9: 111,196,317 (GRCm39) L1447Q probably damaging Het
Trim56 A G 5: 137,141,446 (GRCm39) L690P probably damaging Het
Trmt13 T C 3: 116,376,417 (GRCm39) T325A probably benign Het
Ttn T A 2: 76,539,811 (GRCm39) T34392S probably benign Het
Uncx A G 5: 139,532,571 (GRCm39) E212G probably damaging Het
Ush2a A G 1: 188,679,281 (GRCm39) T4830A probably benign Het
Usp34 C A 11: 23,362,345 (GRCm39) T1616N Het
Vars1 C T 17: 35,234,953 (GRCm39) L1261F possibly damaging Het
Vmn1r223 T C 13: 23,434,020 (GRCm39) S205P probably damaging Het
Vmn2r118 A T 17: 55,917,423 (GRCm39) I363K possibly damaging Het
Vmn2r69 A T 7: 85,064,838 (GRCm39) M16K probably benign Het
Wdr62 G A 7: 29,962,128 (GRCm39) T428I possibly damaging Het
Yeats4 A T 10: 117,053,374 (GRCm39) L129Q probably benign Het
Zfp423 T C 8: 88,509,784 (GRCm39) R187G probably damaging Het
Zfp853 A T 5: 143,274,702 (GRCm39) L321Q unknown Het
Other mutations in Slc22a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Slc22a6 APN 19 8,599,232 (GRCm39) missense probably benign 0.14
IGL00825:Slc22a6 APN 19 8,595,721 (GRCm39) missense possibly damaging 0.94
IGL01362:Slc22a6 APN 19 8,598,572 (GRCm39) missense possibly damaging 0.69
IGL01843:Slc22a6 APN 19 8,603,578 (GRCm39) utr 3 prime probably benign
IGL02583:Slc22a6 APN 19 8,600,980 (GRCm39) missense possibly damaging 0.79
R1004:Slc22a6 UTSW 19 8,595,763 (GRCm39) missense probably damaging 1.00
R1775:Slc22a6 UTSW 19 8,596,471 (GRCm39) critical splice donor site probably null
R1911:Slc22a6 UTSW 19 8,599,246 (GRCm39) missense probably benign
R2365:Slc22a6 UTSW 19 8,596,761 (GRCm39) missense probably benign
R3406:Slc22a6 UTSW 19 8,598,675 (GRCm39) missense probably damaging 1.00
R4106:Slc22a6 UTSW 19 8,595,874 (GRCm39) missense probably benign
R4693:Slc22a6 UTSW 19 8,601,016 (GRCm39) missense probably damaging 1.00
R5094:Slc22a6 UTSW 19 8,603,541 (GRCm39) missense probably damaging 1.00
R5347:Slc22a6 UTSW 19 8,595,917 (GRCm39) missense possibly damaging 0.94
R5360:Slc22a6 UTSW 19 8,596,786 (GRCm39) missense probably damaging 1.00
R5667:Slc22a6 UTSW 19 8,599,148 (GRCm39) critical splice acceptor site probably null
R5810:Slc22a6 UTSW 19 8,601,222 (GRCm39) missense probably damaging 1.00
R6176:Slc22a6 UTSW 19 8,599,161 (GRCm39) missense probably damaging 1.00
R6336:Slc22a6 UTSW 19 8,599,494 (GRCm39) missense probably benign 0.02
R6864:Slc22a6 UTSW 19 8,595,805 (GRCm39) missense probably damaging 1.00
R6954:Slc22a6 UTSW 19 8,599,460 (GRCm39) missense probably benign 0.02
R7298:Slc22a6 UTSW 19 8,598,684 (GRCm39) missense possibly damaging 0.49
R7305:Slc22a6 UTSW 19 8,599,522 (GRCm39) critical splice donor site probably null
R7681:Slc22a6 UTSW 19 8,603,493 (GRCm39) missense probably benign 0.03
R7749:Slc22a6 UTSW 19 8,599,260 (GRCm39) missense possibly damaging 0.48
R7937:Slc22a6 UTSW 19 8,601,253 (GRCm39) missense probably benign 0.07
R8346:Slc22a6 UTSW 19 8,599,169 (GRCm39) missense probably damaging 1.00
R8348:Slc22a6 UTSW 19 8,599,169 (GRCm39) missense probably damaging 1.00
R8363:Slc22a6 UTSW 19 8,596,386 (GRCm39) missense probably benign
R8698:Slc22a6 UTSW 19 8,600,889 (GRCm39) missense probably benign
R9431:Slc22a6 UTSW 19 8,598,596 (GRCm39) missense probably benign 0.10
R9602:Slc22a6 UTSW 19 8,598,560 (GRCm39) nonsense probably null
R9774:Slc22a6 UTSW 19 8,603,134 (GRCm39) missense probably benign 0.00
Z1088:Slc22a6 UTSW 19 8,599,197 (GRCm39) missense probably benign 0.03
Z1176:Slc22a6 UTSW 19 8,600,907 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GGGTCTTTAACAAGCTGACTTTTG -3'
(R):5'- TGATGGCATGAGCGTGACTC -3'

Sequencing Primer
(F):5'- GTCCTTAAAGGGTTCTTGGCAAG -3'
(R):5'- GGAACCTTTTGTATAACCTCTGAGGC -3'
Posted On 2020-09-02