Mutagenetix > Incidental Mutations

Incidental Mutation 'R8348:Cth'

645341

Institutional Source

Beutler Lab

Gene Symbol

Cth

Ensembl Gene

ENSMUSG00000028179

Gene Name

cystathionase (cystathionine gamma-lyase)

Synonyms

CSE, 0610010I13Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8348 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

157894248-157925077 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 157925020 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 4 (D4G)

Ref Sequence

ENSEMBL: ENSMUSP00000113672 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000118539]

Predicted Effect

probably benign
Transcript: ENSMUST00000118539
AA Change: D4G

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000113672
Gene: ENSMUSG00000028179
AA Change: D4G

Domain	Start	End	E-Value	Type
Pfam:Cys_Met_Meta_PP	18	394	5.8e-157	PFAM
Pfam:Aminotran_1_2	32	235	4.3e-9	PFAM
Pfam:DegT_DnrJ_EryC1	53	246	1.9e-7	PFAM
Pfam:Aminotran_5	68	232	4e-7	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic enzyme in the trans-sulfuration pathway that converts cystathione derived from methionine into cysteine. Glutathione synthesis in the liver is dependent upon the availability of cysteine. Mutations in this gene cause cystathioninuria. Alternative splicing of this gene results in three transcript variants encoding different isoforms. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit hypertension associated with impaired endothelium-dependent vasorelaxation. Mice homozygous for another knock-out allele exhibit normal blood pressure but sensitivty to a low cysteine diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	A	T	7: 34,285,144	L18Q	probably damaging	Het
4933430I17Rik	T	C	4: 62,542,785		probably null	Het
Adamts6	T	A	13: 104,479,519	C1030S	probably damaging	Het
Adamtsl3	C	A	7: 82,603,799	T1527K	possibly damaging	Het
Akap9	G	A	5: 3,948,897		probably null	Het
Ankle2	C	A	5: 110,242,043	P457T	possibly damaging	Het
Ankrd7	A	G	6: 18,868,008	N91S	probably damaging	Het
Ascc3	C	A	10: 50,618,077	Q203K	probably benign	Het
Baz2b	A	T	2: 59,911,793	D61E		Het
Bmpr1a	T	A	14: 34,414,802	K477N	probably benign	Het
Cacna1d	T	C	14: 30,102,407	I1040V	probably damaging	Het
Cdkn2a	C	A	4: 89,282,054	V20L	possibly damaging	Het
Chd5	A	G	4: 152,360,716	S385G	probably damaging	Het
Cntrob	A	G	11: 69,299,853	F46L	unknown	Het
Cyld	C	T	8: 88,729,569	H416Y	probably damaging	Het
Dennd6a	C	A	14: 26,606,943	H264Q	possibly damaging	Het
Dnah1	T	C	14: 31,293,725	Y1672C	probably damaging	Het
Dnah8	A	G	17: 30,673,840	I800V	probably benign	Het
Esrp2	A	G	8: 106,132,221	Y595H	probably damaging	Het
F12	T	A	13: 55,418,488	Y497F	probably benign	Het
Fggy	A	G	4: 95,844,190	T473A	probably benign	Het
Gatsl2	T	C	5: 134,138,116	F304L	possibly damaging	Het
Gm21103	C	A	14: 6,301,873	R180L	probably benign	Het
Gm884	T	A	11: 103,620,900	T81S	unknown	Het
Gstt2	C	A	10: 75,832,692	R107L	probably damaging	Het
Hectd4	A	T	5: 121,220,256		probably benign	Het
Helb	A	G	10: 120,102,886	F561S	probably damaging	Het
Ints2	T	C	11: 86,255,423	T120A	probably benign	Het
Kdm5d	G	A	Y: 914,056	R331H	probably benign	Het
Krt6b	A	G	15: 101,678,020	Y345H	probably damaging	Het
Limch1	A	G	5: 67,002,482	K418E	probably damaging	Het
Med17	C	T	9: 15,262,439		probably null	Het
Met	A	T	6: 17,571,800	I1373F	probably benign	Het
Naip6	T	A	13: 100,300,386	Q543L	possibly damaging	Het
Nat9	T	C	11: 115,185,076	T40A	probably damaging	Het
Ogdh	A	G	11: 6,342,619	N455S	probably damaging	Het
Olfr552	C	A	7: 102,605,000	F215L	probably benign	Het
Pde4a	T	C	9: 21,206,238	F599L	probably benign	Het
Pga5	T	C	19: 10,671,809	Y249C	probably damaging	Het
Plekha8	A	T	6: 54,630,554	K382M	probably damaging	Het
Plekhd1	A	T	12: 80,706,375	E119V	probably damaging	Het
Pnp	A	T	14: 50,947,899	H20L	probably benign	Het
Polq	A	T	16: 37,017,197		probably null	Het
Psma3	T	G	12: 70,988,476	I177R	probably damaging	Het
Ptpn3	A	G	4: 57,240,784		probably null	Het
Ptprt	A	T	2: 161,558,886	L1077Q	probably damaging	Het
Rbm47	A	T	5: 66,027,230	M10K	possibly damaging	Het
Rere	A	G	4: 150,619,196	D186G	probably damaging	Het
Rpl24	T	C	16: 55,967,090	S38P	probably damaging	Het
Slco1a1	A	T	6: 141,940,061	F79L	possibly damaging	Het
Sorl1	T	A	9: 41,991,745	D1551V	probably benign	Het
Sos1	C	A	17: 80,434,119	M412I	probably benign	Het
Spast	G	A	17: 74,359,298	V209I	probably benign	Het
Spindoc	G	T	19: 7,358,404	Q340K	possibly damaging	Het
Tlr6	T	C	5: 64,953,842	Y574C	probably damaging	Het
Tnrc6a	A	G	7: 123,192,123	N1748S	possibly damaging	Het
Trbv13-2	A	T	6: 41,121,540	K16N	probably benign	Het
Triobp	C	T	15: 78,994,126	H1750Y	possibly damaging	Het
Ubc	C	T	5: 125,388,031	M77I	probably damaging	Het
Usp24	A	G	4: 106,368,736	D659G	possibly damaging	Het
Vmn2r88	T	A	14: 51,418,796	C821S	probably damaging	Het
Whamm	T	A	7: 81,574,547	V197D	probably damaging	Het
Zfp777	A	G	6: 48,029,167	F431S	probably damaging	Het

Other mutations in Cth

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01462:Cth	APN	3	157905167	missense	probably damaging	0.99
IGL01744:Cth	APN	3	157924935	missense	probably benign
IGL03128:Cth	APN	3	157921035	missense	probably damaging	1.00
R0477:Cth	UTSW	3	157905175	missense	probably damaging	1.00
R0659:Cth	UTSW	3	157920115	splice site	probably benign
R1699:Cth	UTSW	3	157907436	missense	probably damaging	1.00
R1724:Cth	UTSW	3	157913727	missense	probably damaging	1.00
R1744:Cth	UTSW	3	157906268	missense	probably damaging	0.99
R3822:Cth	UTSW	3	157918499	missense	probably benign	0.27
R3937:Cth	UTSW	3	157920040	missense	possibly damaging	0.79
R3982:Cth	UTSW	3	157913697	nonsense	probably null
R4342:Cth	UTSW	3	157924976	missense	probably damaging	1.00
R5436:Cth	UTSW	3	157894826	missense	probably benign
R7466:Cth	UTSW	3	157924885	missense	probably benign	0.05
R8448:Cth	UTSW	3	157925020	missense	probably benign	0.19

Predicted Primers

PCR Primer
(F):5'- TTAACTGAAAATCGCAGAGAGC -3'
(R):5'- CCTATCCTGCAGACAAAGGG -3'

Sequencing Primer
(F):5'- AGAGAGCGCATGTCCCGAG -3'
(R):5'- TATCCTGCAGACAAAGGGGATCTC -3'

Posted On

2020-09-02