Incidental Mutation 'R8348:Fggy'
ID645345
Institutional Source Beutler Lab
Gene Symbol Fggy
Ensembl Gene ENSMUSG00000028573
Gene NameFGGY carbohydrate kinase domain containing
Synonyms2310009E04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8348 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location95557507-95926939 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95844190 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 473 (T473A)
Ref Sequence ENSEMBL: ENSMUSP00000078216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079223] [ENSMUST00000107091] [ENSMUST00000130541]
Predicted Effect probably benign
Transcript: ENSMUST00000079223
AA Change: T473A

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000078216
Gene: ENSMUSG00000028573
AA Change: T473A

DomainStartEndE-ValueType
Pfam:FGGY_N 12 268 3.3e-27 PFAM
Pfam:FGGY_C 290 498 1.1e-50 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107091
AA Change: T385A

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102706
Gene: ENSMUSG00000028573
AA Change: T385A

DomainStartEndE-ValueType
Pfam:FGGY_N 12 78 1.7e-10 PFAM
Pfam:FGGY_C 202 410 1.5e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130541
SMART Domains Protein: ENSMUSP00000115688
Gene: ENSMUSG00000028573

DomainStartEndE-ValueType
Pfam:FGGY_C 1 150 3.3e-23 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000118147
Gene: ENSMUSG00000028573
AA Change: T114A

DomainStartEndE-ValueType
Pfam:FGGY_C 6 124 8.5e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that phosphorylates carbohydrates such as ribulose, ribitol, and L-arabinitol. Genome-wide association studies in some populations have found an association between polymorphisms in this gene and sporadic amyotrophic lateral sclerosis, but studies of other populations have not been able to replicate this association. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,285,144 L18Q probably damaging Het
4933430I17Rik T C 4: 62,542,785 probably null Het
Adamts6 T A 13: 104,479,519 C1030S probably damaging Het
Adamtsl3 C A 7: 82,603,799 T1527K possibly damaging Het
Akap9 G A 5: 3,948,897 probably null Het
Ankle2 C A 5: 110,242,043 P457T possibly damaging Het
Ankrd7 A G 6: 18,868,008 N91S probably damaging Het
Ascc3 C A 10: 50,618,077 Q203K probably benign Het
Baz2b A T 2: 59,911,793 D61E Het
Bmpr1a T A 14: 34,414,802 K477N probably benign Het
Cacna1d T C 14: 30,102,407 I1040V probably damaging Het
Cdkn2a C A 4: 89,282,054 V20L possibly damaging Het
Chd5 A G 4: 152,360,716 S385G probably damaging Het
Cntrob A G 11: 69,299,853 F46L unknown Het
Cth T C 3: 157,925,020 D4G probably benign Het
Cyld C T 8: 88,729,569 H416Y probably damaging Het
Dennd6a C A 14: 26,606,943 H264Q possibly damaging Het
Dnah1 T C 14: 31,293,725 Y1672C probably damaging Het
Dnah8 A G 17: 30,673,840 I800V probably benign Het
Esrp2 A G 8: 106,132,221 Y595H probably damaging Het
F12 T A 13: 55,418,488 Y497F probably benign Het
Gatsl2 T C 5: 134,138,116 F304L possibly damaging Het
Gm21103 C A 14: 6,301,873 R180L probably benign Het
Gm884 T A 11: 103,620,900 T81S unknown Het
Gstt2 C A 10: 75,832,692 R107L probably damaging Het
Hectd4 A T 5: 121,220,256 probably benign Het
Helb A G 10: 120,102,886 F561S probably damaging Het
Ints2 T C 11: 86,255,423 T120A probably benign Het
Kdm5d G A Y: 914,056 R331H probably benign Het
Krt6b A G 15: 101,678,020 Y345H probably damaging Het
Limch1 A G 5: 67,002,482 K418E probably damaging Het
Med17 C T 9: 15,262,439 probably null Het
Met A T 6: 17,571,800 I1373F probably benign Het
Naip6 T A 13: 100,300,386 Q543L possibly damaging Het
Nat9 T C 11: 115,185,076 T40A probably damaging Het
Ogdh A G 11: 6,342,619 N455S probably damaging Het
Olfr552 C A 7: 102,605,000 F215L probably benign Het
Pde4a T C 9: 21,206,238 F599L probably benign Het
Pga5 T C 19: 10,671,809 Y249C probably damaging Het
Plekha8 A T 6: 54,630,554 K382M probably damaging Het
Plekhd1 A T 12: 80,706,375 E119V probably damaging Het
Pnp A T 14: 50,947,899 H20L probably benign Het
Polq A T 16: 37,017,197 probably null Het
Psma3 T G 12: 70,988,476 I177R probably damaging Het
Ptpn3 A G 4: 57,240,784 probably null Het
Ptprt A T 2: 161,558,886 L1077Q probably damaging Het
Rbm47 A T 5: 66,027,230 M10K possibly damaging Het
Rere A G 4: 150,619,196 D186G probably damaging Het
Rpl24 T C 16: 55,967,090 S38P probably damaging Het
Slco1a1 A T 6: 141,940,061 F79L possibly damaging Het
Sorl1 T A 9: 41,991,745 D1551V probably benign Het
Sos1 C A 17: 80,434,119 M412I probably benign Het
Spast G A 17: 74,359,298 V209I probably benign Het
Spindoc G T 19: 7,358,404 Q340K possibly damaging Het
Tlr6 T C 5: 64,953,842 Y574C probably damaging Het
Tnrc6a A G 7: 123,192,123 N1748S possibly damaging Het
Trbv13-2 A T 6: 41,121,540 K16N probably benign Het
Triobp C T 15: 78,994,126 H1750Y possibly damaging Het
Ubc C T 5: 125,388,031 M77I probably damaging Het
Usp24 A G 4: 106,368,736 D659G possibly damaging Het
Vmn2r88 T A 14: 51,418,796 C821S probably damaging Het
Whamm T A 7: 81,574,547 V197D probably damaging Het
Zfp777 A G 6: 48,029,167 F431S probably damaging Het
Other mutations in Fggy
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Fggy APN 4 95837628 missense possibly damaging 0.86
IGL02377:Fggy APN 4 95623477 unclassified probably benign
IGL02417:Fggy APN 4 95849609 missense probably benign 0.01
IGL02527:Fggy APN 4 95697069 missense probably damaging 1.00
IGL02967:Fggy APN 4 95926749 missense possibly damaging 0.74
IGL03053:Fggy APN 4 95926809 unclassified probably benign
IGL03168:Fggy APN 4 95926809 unclassified probably benign
IGL03370:Fggy APN 4 95822064 missense probably damaging 1.00
R0164:Fggy UTSW 4 95837654 missense probably damaging 0.97
R0164:Fggy UTSW 4 95837654 missense probably damaging 0.97
R0312:Fggy UTSW 4 95844185 missense probably damaging 1.00
R0520:Fggy UTSW 4 95601103 missense probably damaging 1.00
R0747:Fggy UTSW 4 95812100 splice site probably benign
R0940:Fggy UTSW 4 95697001 missense probably benign 0.40
R1513:Fggy UTSW 4 95902058 intron probably benign
R1746:Fggy UTSW 4 95926728 missense probably damaging 1.00
R2998:Fggy UTSW 4 95849585 missense probably benign 0.01
R3848:Fggy UTSW 4 95601124 unclassified probably benign
R4913:Fggy UTSW 4 95697076 critical splice donor site probably null
R5458:Fggy UTSW 4 95926743 missense probably benign
R5868:Fggy UTSW 4 95696988 missense probably damaging 0.99
R6583:Fggy UTSW 4 95600973 missense probably benign 0.01
R6589:Fggy UTSW 4 95597638 missense probably benign 0.00
R7332:Fggy UTSW 4 95623482 missense probably damaging 0.98
R7359:Fggy UTSW 4 95769480 missense probably benign 0.40
R7453:Fggy UTSW 4 95597690 missense probably damaging 1.00
R7603:Fggy UTSW 4 95769506 missense probably damaging 1.00
R7806:Fggy UTSW 4 95600966 missense probably benign 0.02
R8072:Fggy UTSW 4 95844157 missense possibly damaging 0.75
R8199:Fggy UTSW 4 95812144 missense probably benign 0.10
R8430:Fggy UTSW 4 95926765 utr 3 prime probably benign
R8448:Fggy UTSW 4 95844190 missense probably benign 0.11
R8503:Fggy UTSW 4 95902058 intron probably benign
R8682:Fggy UTSW 4 95812121 missense probably damaging 1.00
X0067:Fggy UTSW 4 95696992 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAATCTCTAGGAGGGTAAGGC -3'
(R):5'- ACTGCACATATCTGAGAGTGC -3'

Sequencing Primer
(F):5'- CACATGCCAAATATGAGAGTTGCTG -3'
(R):5'- CACCACAATGGTTCCCTA -3'
Posted On2020-09-02