Incidental Mutation 'R8348:Tlr6'
ID645350
Institutional Source Beutler Lab
Gene Symbol Tlr6
Ensembl Gene ENSMUSG00000051498
Gene Nametoll-like receptor 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R8348 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location64952031-64960097 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64953842 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 574 (Y574C)
Ref Sequence ENSEMBL: ENSMUSP00000062096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062315] [ENSMUST00000201307]
Predicted Effect probably damaging
Transcript: ENSMUST00000062315
AA Change: Y574C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062096
Gene: ENSMUSG00000051498
AA Change: Y574C

DomainStartEndE-ValueType
LRR_TYP 86 109 7.67e-2 SMART
LRR 131 155 2.76e1 SMART
LRR 461 482 6.23e1 SMART
LRR 483 507 4.57e0 SMART
LRRCT 540 594 4.06e-11 SMART
transmembrane domain 596 618 N/A INTRINSIC
TIR 652 795 5.37e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201307
SMART Domains Protein: ENSMUSP00000143865
Gene: ENSMUSG00000051498

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
LRR_TYP 86 109 3.3e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor functionally interacts with toll-like receptor 2 to mediate cellular response to bacterial lipoproteins. A Ser249Pro polymorphism in the extracellular domain of the encoded protein may be associated with an increased of asthma is some populations.[provided by RefSeq, Jan 2011]
PHENOTYPE: Inactivation of this gene results in abnormal macrophage function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,285,144 L18Q probably damaging Het
4933430I17Rik T C 4: 62,542,785 probably null Het
Adamts6 T A 13: 104,479,519 C1030S probably damaging Het
Adamtsl3 C A 7: 82,603,799 T1527K possibly damaging Het
Akap9 G A 5: 3,948,897 probably null Het
Ankle2 C A 5: 110,242,043 P457T possibly damaging Het
Ankrd7 A G 6: 18,868,008 N91S probably damaging Het
Ascc3 C A 10: 50,618,077 Q203K probably benign Het
Baz2b A T 2: 59,911,793 D61E Het
Bmpr1a T A 14: 34,414,802 K477N probably benign Het
Cacna1d T C 14: 30,102,407 I1040V probably damaging Het
Cdkn2a C A 4: 89,282,054 V20L possibly damaging Het
Chd5 A G 4: 152,360,716 S385G probably damaging Het
Cntrob A G 11: 69,299,853 F46L unknown Het
Cth T C 3: 157,925,020 D4G probably benign Het
Cyld C T 8: 88,729,569 H416Y probably damaging Het
Dennd6a C A 14: 26,606,943 H264Q possibly damaging Het
Dnah1 T C 14: 31,293,725 Y1672C probably damaging Het
Dnah8 A G 17: 30,673,840 I800V probably benign Het
Esrp2 A G 8: 106,132,221 Y595H probably damaging Het
F12 T A 13: 55,418,488 Y497F probably benign Het
Fggy A G 4: 95,844,190 T473A probably benign Het
Gatsl2 T C 5: 134,138,116 F304L possibly damaging Het
Gm21103 C A 14: 6,301,873 R180L probably benign Het
Gm884 T A 11: 103,620,900 T81S unknown Het
Gstt2 C A 10: 75,832,692 R107L probably damaging Het
Hectd4 A T 5: 121,220,256 probably benign Het
Helb A G 10: 120,102,886 F561S probably damaging Het
Ints2 T C 11: 86,255,423 T120A probably benign Het
Kdm5d G A Y: 914,056 R331H probably benign Het
Krt6b A G 15: 101,678,020 Y345H probably damaging Het
Limch1 A G 5: 67,002,482 K418E probably damaging Het
Med17 C T 9: 15,262,439 probably null Het
Met A T 6: 17,571,800 I1373F probably benign Het
Naip6 T A 13: 100,300,386 Q543L possibly damaging Het
Nat9 T C 11: 115,185,076 T40A probably damaging Het
Ogdh A G 11: 6,342,619 N455S probably damaging Het
Olfr552 C A 7: 102,605,000 F215L probably benign Het
Pde4a T C 9: 21,206,238 F599L probably benign Het
Pga5 T C 19: 10,671,809 Y249C probably damaging Het
Plekha8 A T 6: 54,630,554 K382M probably damaging Het
Plekhd1 A T 12: 80,706,375 E119V probably damaging Het
Pnp A T 14: 50,947,899 H20L probably benign Het
Polq A T 16: 37,017,197 probably null Het
Psma3 T G 12: 70,988,476 I177R probably damaging Het
Ptpn3 A G 4: 57,240,784 probably null Het
Ptprt A T 2: 161,558,886 L1077Q probably damaging Het
Rbm47 A T 5: 66,027,230 M10K possibly damaging Het
Rere A G 4: 150,619,196 D186G probably damaging Het
Rpl24 T C 16: 55,967,090 S38P probably damaging Het
Slco1a1 A T 6: 141,940,061 F79L possibly damaging Het
Sorl1 T A 9: 41,991,745 D1551V probably benign Het
Sos1 C A 17: 80,434,119 M412I probably benign Het
Spast G A 17: 74,359,298 V209I probably benign Het
Spindoc G T 19: 7,358,404 Q340K possibly damaging Het
Tnrc6a A G 7: 123,192,123 N1748S possibly damaging Het
Trbv13-2 A T 6: 41,121,540 K16N probably benign Het
Triobp C T 15: 78,994,126 H1750Y possibly damaging Het
Ubc C T 5: 125,388,031 M77I probably damaging Het
Usp24 A G 4: 106,368,736 D659G possibly damaging Het
Vmn2r88 T A 14: 51,418,796 C821S probably damaging Het
Whamm T A 7: 81,574,547 V197D probably damaging Het
Zfp777 A G 6: 48,029,167 F431S probably damaging Het
Other mutations in Tlr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Tlr6 APN 5 64953512 missense probably damaging 1.00
IGL00963:Tlr6 APN 5 64954676 missense possibly damaging 0.89
IGL01540:Tlr6 APN 5 64955286 missense probably damaging 0.97
IGL01675:Tlr6 APN 5 64954499 missense probably damaging 1.00
IGL01705:Tlr6 APN 5 64954130 missense probably benign 0.03
IGL02256:Tlr6 APN 5 64954944 missense probably benign 0.00
Counterintuitive UTSW 5 64953595 missense probably damaging 1.00
insouciant UTSW 5 64954583 missense possibly damaging 0.81
m2sd1 UTSW 5 64954194 nonsense
m2sd2 UTSW 5 64954394 nonsense
m2sd3 UTSW 5 64954241 missense probably damaging 0.98
One_off UTSW 5 64953251 missense probably damaging 1.00
R0336:Tlr6 UTSW 5 64953946 missense probably benign 0.02
R0388:Tlr6 UTSW 5 64955205 missense possibly damaging 0.74
R0558:Tlr6 UTSW 5 64954860 nonsense probably null
R0671:Tlr6 UTSW 5 64954592 missense probably benign 0.00
R1171:Tlr6 UTSW 5 64955250 missense probably benign 0.00
R1550:Tlr6 UTSW 5 64953411 missense probably damaging 0.98
R1809:Tlr6 UTSW 5 64953712 nonsense probably null
R1868:Tlr6 UTSW 5 64954829 missense probably benign 0.00
R1876:Tlr6 UTSW 5 64955420 missense probably damaging 1.00
R1893:Tlr6 UTSW 5 64953213 missense probably damaging 1.00
R2006:Tlr6 UTSW 5 64953405 missense probably damaging 1.00
R2055:Tlr6 UTSW 5 64953926 missense probably damaging 1.00
R3087:Tlr6 UTSW 5 64954325 missense probably damaging 1.00
R3406:Tlr6 UTSW 5 64953429 missense probably damaging 1.00
R3711:Tlr6 UTSW 5 64953809 missense possibly damaging 0.75
R3938:Tlr6 UTSW 5 64953595 missense probably damaging 1.00
R3962:Tlr6 UTSW 5 64954985 missense probably benign 0.10
R4152:Tlr6 UTSW 5 64953212 missense probably damaging 1.00
R4274:Tlr6 UTSW 5 64953638 missense probably benign 0.01
R4516:Tlr6 UTSW 5 64954904 missense possibly damaging 0.67
R4518:Tlr6 UTSW 5 64954904 missense possibly damaging 0.67
R4762:Tlr6 UTSW 5 64954396 missense probably benign 0.09
R4959:Tlr6 UTSW 5 64953659 missense possibly damaging 0.81
R5119:Tlr6 UTSW 5 64954301 missense probably benign 0.06
R5248:Tlr6 UTSW 5 64955304 missense probably benign 0.30
R5507:Tlr6 UTSW 5 64953406 missense probably damaging 1.00
R5572:Tlr6 UTSW 5 64955018 missense probably damaging 1.00
R5773:Tlr6 UTSW 5 64954503 missense probably benign 0.00
R6711:Tlr6 UTSW 5 64954492 missense probably damaging 1.00
R7096:Tlr6 UTSW 5 64953776 missense probably benign
R7341:Tlr6 UTSW 5 64953629 missense probably benign 0.32
R7594:Tlr6 UTSW 5 64953251 missense probably damaging 1.00
R7754:Tlr6 UTSW 5 64954350 missense possibly damaging 0.64
R7774:Tlr6 UTSW 5 64953385 missense probably damaging 0.99
R8292:Tlr6 UTSW 5 64953791 missense probably damaging 1.00
R8376:Tlr6 UTSW 5 64955112 missense probably benign 0.00
R8448:Tlr6 UTSW 5 64953842 missense probably damaging 1.00
Z1177:Tlr6 UTSW 5 64955239 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGTCCACTGACACAGCATCC -3'
(R):5'- TAACTGACCTTCCTGGGTGTG -3'

Sequencing Primer
(F):5'- CTCACATACCAGGGCAGGTC -3'
(R):5'- CAGCAGCCTTTCTGTGCTGG -3'
Posted On2020-09-02