Incidental Mutation 'R8348:Med17'
ID645370
Institutional Source Beutler Lab
Gene Symbol Med17
Ensembl Gene ENSMUSG00000031935
Gene Namemediator complex subunit 17
SynonymsTrap80, C330002H14Rik, Crsp6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R8348 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location15260351-15279931 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) C to T at 15262439 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034411] [ENSMUST00000034413] [ENSMUST00000213788]
Predicted Effect probably null
Transcript: ENSMUST00000034411
SMART Domains Protein: ENSMUSP00000034411
Gene: ENSMUSG00000031935

DomainStartEndE-ValueType
low complexity region 51 82 N/A INTRINSIC
Pfam:Med17 123 452 8.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000034413
SMART Domains Protein: ENSMUSP00000034413
Gene: ENSMUSG00000031937

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
IG 39 138 2e-3 SMART
transmembrane domain 147 169 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000213788
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,285,144 L18Q probably damaging Het
4933430I17Rik T C 4: 62,542,785 probably null Het
Adamts6 T A 13: 104,479,519 C1030S probably damaging Het
Adamtsl3 C A 7: 82,603,799 T1527K possibly damaging Het
Akap9 G A 5: 3,948,897 probably null Het
Ankle2 C A 5: 110,242,043 P457T possibly damaging Het
Ankrd7 A G 6: 18,868,008 N91S probably damaging Het
Ascc3 C A 10: 50,618,077 Q203K probably benign Het
Baz2b A T 2: 59,911,793 D61E Het
Bmpr1a T A 14: 34,414,802 K477N probably benign Het
Cacna1d T C 14: 30,102,407 I1040V probably damaging Het
Cdkn2a C A 4: 89,282,054 V20L possibly damaging Het
Chd5 A G 4: 152,360,716 S385G probably damaging Het
Cntrob A G 11: 69,299,853 F46L unknown Het
Cth T C 3: 157,925,020 D4G probably benign Het
Cyld C T 8: 88,729,569 H416Y probably damaging Het
Dennd6a C A 14: 26,606,943 H264Q possibly damaging Het
Dnah1 T C 14: 31,293,725 Y1672C probably damaging Het
Dnah8 A G 17: 30,673,840 I800V probably benign Het
Esrp2 A G 8: 106,132,221 Y595H probably damaging Het
F12 T A 13: 55,418,488 Y497F probably benign Het
Fggy A G 4: 95,844,190 T473A probably benign Het
Gatsl2 T C 5: 134,138,116 F304L possibly damaging Het
Gm21103 C A 14: 6,301,873 R180L probably benign Het
Gm884 T A 11: 103,620,900 T81S unknown Het
Gstt2 C A 10: 75,832,692 R107L probably damaging Het
Hectd4 A T 5: 121,220,256 probably benign Het
Helb A G 10: 120,102,886 F561S probably damaging Het
Ints2 T C 11: 86,255,423 T120A probably benign Het
Kdm5d G A Y: 914,056 R331H probably benign Het
Krt6b A G 15: 101,678,020 Y345H probably damaging Het
Limch1 A G 5: 67,002,482 K418E probably damaging Het
Met A T 6: 17,571,800 I1373F probably benign Het
Naip6 T A 13: 100,300,386 Q543L possibly damaging Het
Nat9 T C 11: 115,185,076 T40A probably damaging Het
Ogdh A G 11: 6,342,619 N455S probably damaging Het
Olfr552 C A 7: 102,605,000 F215L probably benign Het
Pde4a T C 9: 21,206,238 F599L probably benign Het
Pga5 T C 19: 10,671,809 Y249C probably damaging Het
Plekha8 A T 6: 54,630,554 K382M probably damaging Het
Plekhd1 A T 12: 80,706,375 E119V probably damaging Het
Pnp A T 14: 50,947,899 H20L probably benign Het
Polq A T 16: 37,017,197 probably null Het
Psma3 T G 12: 70,988,476 I177R probably damaging Het
Ptpn3 A G 4: 57,240,784 probably null Het
Ptprt A T 2: 161,558,886 L1077Q probably damaging Het
Rbm47 A T 5: 66,027,230 M10K possibly damaging Het
Rere A G 4: 150,619,196 D186G probably damaging Het
Rpl24 T C 16: 55,967,090 S38P probably damaging Het
Slco1a1 A T 6: 141,940,061 F79L possibly damaging Het
Sorl1 T A 9: 41,991,745 D1551V probably benign Het
Sos1 C A 17: 80,434,119 M412I probably benign Het
Spast G A 17: 74,359,298 V209I probably benign Het
Spindoc G T 19: 7,358,404 Q340K possibly damaging Het
Tlr6 T C 5: 64,953,842 Y574C probably damaging Het
Tnrc6a A G 7: 123,192,123 N1748S possibly damaging Het
Trbv13-2 A T 6: 41,121,540 K16N probably benign Het
Triobp C T 15: 78,994,126 H1750Y possibly damaging Het
Ubc C T 5: 125,388,031 M77I probably damaging Het
Usp24 A G 4: 106,368,736 D659G possibly damaging Het
Vmn2r88 T A 14: 51,418,796 C821S probably damaging Het
Whamm T A 7: 81,574,547 V197D probably damaging Het
Zfp777 A G 6: 48,029,167 F431S probably damaging Het
Other mutations in Med17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Med17 APN 9 15279621 missense probably benign 0.19
IGL02263:Med17 APN 9 15267476 missense probably damaging 0.98
IGL02390:Med17 APN 9 15277667 nonsense probably null
IGL02391:Med17 APN 9 15277667 nonsense probably null
IGL02392:Med17 APN 9 15277667 nonsense probably null
IGL02393:Med17 APN 9 15277667 nonsense probably null
IGL02591:Med17 APN 9 15270361 missense probably damaging 1.00
IGL02635:Med17 APN 9 15274549 missense probably damaging 1.00
IGL02745:Med17 APN 9 15265346 splice site probably benign
IGL02815:Med17 APN 9 15262267 missense probably damaging 1.00
IGL02897:Med17 APN 9 15267534 missense probably damaging 1.00
R1448:Med17 UTSW 9 15275843 splice site probably null
R2912:Med17 UTSW 9 15275914 missense probably damaging 1.00
R2937:Med17 UTSW 9 15275891 missense probably damaging 0.99
R3715:Med17 UTSW 9 15263766 splice site probably benign
R4175:Med17 UTSW 9 15267469 missense possibly damaging 0.93
R4557:Med17 UTSW 9 15271697 missense possibly damaging 0.86
R4701:Med17 UTSW 9 15270360 missense probably damaging 1.00
R4865:Med17 UTSW 9 15265372 nonsense probably null
R5169:Med17 UTSW 9 15277604 missense probably benign 0.03
R5510:Med17 UTSW 9 15270404 missense probably benign
R6326:Med17 UTSW 9 15279558 missense probably benign 0.32
R6393:Med17 UTSW 9 15274583 missense probably damaging 1.00
R6598:Med17 UTSW 9 15271700 missense probably benign 0.29
R7722:Med17 UTSW 9 15271691 missense probably benign 0.01
R8181:Med17 UTSW 9 15277632 missense possibly damaging 0.75
R8377:Med17 UTSW 9 15262359 missense probably damaging 1.00
R8448:Med17 UTSW 9 15262439 critical splice acceptor site probably null
R8754:Med17 UTSW 9 15277600 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- AACTTGTTCTGGAGAAAATCACAGC -3'
(R):5'- ACTATGCAGTCAGAAGCAGCC -3'

Sequencing Primer
(F):5'- TCAGGGCAGACATAAGCAGCTC -3'
(R):5'- GTCAGAAGCAGCCTCGAACTC -3'
Posted On2020-09-02