Incidental Mutation 'R8348:Krt6b'
ID645394
Institutional Source Beutler Lab
Gene Symbol Krt6b
Ensembl Gene ENSMUSG00000023041
Gene Namekeratin 6B
SynonymsKrt2-6b, mK6[b]
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R8348 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location101676023-101680287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101678020 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 345 (Y345H)
Ref Sequence ENSEMBL: ENSMUSP00000023786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023786]
Predicted Effect probably damaging
Transcript: ENSMUST00000023786
AA Change: Y345H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023786
Gene: ENSMUSG00000023041
AA Change: Y345H

DomainStartEndE-ValueType
Pfam:Keratin_2_head 15 148 1.3e-36 PFAM
Filament 151 464 2.79e-175 SMART
low complexity region 483 537 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,285,144 L18Q probably damaging Het
4933430I17Rik T C 4: 62,542,785 probably null Het
Adamts6 T A 13: 104,479,519 C1030S probably damaging Het
Adamtsl3 C A 7: 82,603,799 T1527K possibly damaging Het
Akap9 G A 5: 3,948,897 probably null Het
Ankle2 C A 5: 110,242,043 P457T possibly damaging Het
Ankrd7 A G 6: 18,868,008 N91S probably damaging Het
Ascc3 C A 10: 50,618,077 Q203K probably benign Het
Baz2b A T 2: 59,911,793 D61E Het
Bmpr1a T A 14: 34,414,802 K477N probably benign Het
Cacna1d T C 14: 30,102,407 I1040V probably damaging Het
Cdkn2a C A 4: 89,282,054 V20L possibly damaging Het
Chd5 A G 4: 152,360,716 S385G probably damaging Het
Cntrob A G 11: 69,299,853 F46L unknown Het
Cth T C 3: 157,925,020 D4G probably benign Het
Cyld C T 8: 88,729,569 H416Y probably damaging Het
Dennd6a C A 14: 26,606,943 H264Q possibly damaging Het
Dnah1 T C 14: 31,293,725 Y1672C probably damaging Het
Dnah8 A G 17: 30,673,840 I800V probably benign Het
Esrp2 A G 8: 106,132,221 Y595H probably damaging Het
F12 T A 13: 55,418,488 Y497F probably benign Het
Fggy A G 4: 95,844,190 T473A probably benign Het
Gatsl2 T C 5: 134,138,116 F304L possibly damaging Het
Gm21103 C A 14: 6,301,873 R180L probably benign Het
Gm884 T A 11: 103,620,900 T81S unknown Het
Gstt2 C A 10: 75,832,692 R107L probably damaging Het
Hectd4 A T 5: 121,220,256 probably benign Het
Helb A G 10: 120,102,886 F561S probably damaging Het
Ints2 T C 11: 86,255,423 T120A probably benign Het
Kdm5d G A Y: 914,056 R331H probably benign Het
Limch1 A G 5: 67,002,482 K418E probably damaging Het
Med17 C T 9: 15,262,439 probably null Het
Met A T 6: 17,571,800 I1373F probably benign Het
Naip6 T A 13: 100,300,386 Q543L possibly damaging Het
Nat9 T C 11: 115,185,076 T40A probably damaging Het
Ogdh A G 11: 6,342,619 N455S probably damaging Het
Olfr552 C A 7: 102,605,000 F215L probably benign Het
Pde4a T C 9: 21,206,238 F599L probably benign Het
Pga5 T C 19: 10,671,809 Y249C probably damaging Het
Plekha8 A T 6: 54,630,554 K382M probably damaging Het
Plekhd1 A T 12: 80,706,375 E119V probably damaging Het
Pnp A T 14: 50,947,899 H20L probably benign Het
Polq A T 16: 37,017,197 probably null Het
Psma3 T G 12: 70,988,476 I177R probably damaging Het
Ptpn3 A G 4: 57,240,784 probably null Het
Ptprt A T 2: 161,558,886 L1077Q probably damaging Het
Rbm47 A T 5: 66,027,230 M10K possibly damaging Het
Rere A G 4: 150,619,196 D186G probably damaging Het
Rpl24 T C 16: 55,967,090 S38P probably damaging Het
Slco1a1 A T 6: 141,940,061 F79L possibly damaging Het
Sorl1 T A 9: 41,991,745 D1551V probably benign Het
Sos1 C A 17: 80,434,119 M412I probably benign Het
Spast G A 17: 74,359,298 V209I probably benign Het
Spindoc G T 19: 7,358,404 Q340K possibly damaging Het
Tlr6 T C 5: 64,953,842 Y574C probably damaging Het
Tnrc6a A G 7: 123,192,123 N1748S possibly damaging Het
Trbv13-2 A T 6: 41,121,540 K16N probably benign Het
Triobp C T 15: 78,994,126 H1750Y possibly damaging Het
Ubc C T 5: 125,388,031 M77I probably damaging Het
Usp24 A G 4: 106,368,736 D659G possibly damaging Het
Vmn2r88 T A 14: 51,418,796 C821S probably damaging Het
Whamm T A 7: 81,574,547 V197D probably damaging Het
Zfp777 A G 6: 48,029,167 F431S probably damaging Het
Other mutations in Krt6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Krt6b APN 15 101679832 missense probably benign 0.22
IGL01653:Krt6b APN 15 101679114 missense probably damaging 1.00
IGL01900:Krt6b APN 15 101677546 missense possibly damaging 0.45
IGL03187:Krt6b APN 15 101679957 missense probably benign
R0511:Krt6b UTSW 15 101677607 splice site probably benign
R0788:Krt6b UTSW 15 101677519 missense probably damaging 0.96
R1370:Krt6b UTSW 15 101677552 missense probably damaging 0.96
R1481:Krt6b UTSW 15 101678374 missense probably benign 0.05
R2007:Krt6b UTSW 15 101678127 missense probably damaging 1.00
R2112:Krt6b UTSW 15 101678564 missense possibly damaging 0.48
R2166:Krt6b UTSW 15 101678615 critical splice acceptor site probably null
R2227:Krt6b UTSW 15 101679122 missense probably damaging 0.96
R2495:Krt6b UTSW 15 101678322 missense probably damaging 1.00
R2496:Krt6b UTSW 15 101679781 missense probably damaging 1.00
R4726:Krt6b UTSW 15 101678085 missense probably damaging 0.98
R4969:Krt6b UTSW 15 101680025 missense possibly damaging 0.71
R6301:Krt6b UTSW 15 101678951 missense probably damaging 1.00
R6646:Krt6b UTSW 15 101677214 missense probably damaging 0.98
R7232:Krt6b UTSW 15 101678142 missense probably damaging 1.00
R7406:Krt6b UTSW 15 101679078 missense probably benign 0.04
R7414:Krt6b UTSW 15 101679014 missense probably benign 0.05
R7849:Krt6b UTSW 15 101678574 missense probably damaging 1.00
R8110:Krt6b UTSW 15 101680142 missense probably damaging 0.96
R8448:Krt6b UTSW 15 101678020 missense probably damaging 1.00
R8736:Krt6b UTSW 15 101678612 missense probably damaging 1.00
Z1177:Krt6b UTSW 15 101678332 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCATGGACCCCATTTATGG -3'
(R):5'- ATTGTGGCAATTTCTGTTCTCCAG -3'

Sequencing Primer
(F):5'- ATGGACCCCATTTATGGCAACTTTG -3'
(R):5'- GGAACTGTCTCAGATGCAAACTC -3'
Posted On2020-09-02