Incidental Mutation 'R8348:Krt6b'
ID 645394
Institutional Source Beutler Lab
Gene Symbol Krt6b
Ensembl Gene ENSMUSG00000023041
Gene Name keratin 6B
Synonyms mK6[b], Krt2-6b
MMRRC Submission 067732-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.101) question?
Stock # R8348 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 101584458-101588722 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 101586455 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 345 (Y345H)
Ref Sequence ENSEMBL: ENSMUSP00000023786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023786]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000023786
AA Change: Y345H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023786
Gene: ENSMUSG00000023041
AA Change: Y345H

DomainStartEndE-ValueType
Pfam:Keratin_2_head 15 148 1.3e-36 PFAM
Filament 151 464 2.79e-175 SMART
low complexity region 483 537 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T C 4: 62,461,022 (GRCm39) probably null Het
Adamts6 T A 13: 104,616,027 (GRCm39) C1030S probably damaging Het
Adamtsl3 C A 7: 82,253,007 (GRCm39) T1527K possibly damaging Het
Akap9 G A 5: 3,998,897 (GRCm39) probably null Het
Ankle2 C A 5: 110,389,909 (GRCm39) P457T possibly damaging Het
Ankrd7 A G 6: 18,868,007 (GRCm39) N91S probably damaging Het
Ascc3 C A 10: 50,494,173 (GRCm39) Q203K probably benign Het
Baz2b A T 2: 59,742,137 (GRCm39) D61E Het
Bmpr1a T A 14: 34,136,759 (GRCm39) K477N probably benign Het
Cacna1d T C 14: 29,824,364 (GRCm39) I1040V probably damaging Het
Castor2 T C 5: 134,166,955 (GRCm39) F304L possibly damaging Het
Cdkn2a C A 4: 89,200,291 (GRCm39) V20L possibly damaging Het
Chd5 A G 4: 152,445,173 (GRCm39) S385G probably damaging Het
Cntrob A G 11: 69,190,679 (GRCm39) F46L unknown Het
Cth T C 3: 157,630,657 (GRCm39) D4G probably benign Het
Cyld C T 8: 89,456,197 (GRCm39) H416Y probably damaging Het
Dennd6a C A 14: 26,328,098 (GRCm39) H264Q possibly damaging Het
Dnah1 T C 14: 31,015,682 (GRCm39) Y1672C probably damaging Het
Dnah8 A G 17: 30,892,814 (GRCm39) I800V probably benign Het
Esrp2 A G 8: 106,858,853 (GRCm39) Y595H probably damaging Het
F12 T A 13: 55,566,301 (GRCm39) Y497F probably benign Het
Fggy A G 4: 95,732,427 (GRCm39) T473A probably benign Het
Garre1 A T 7: 33,984,569 (GRCm39) L18Q probably damaging Het
Gm21103 C A 14: 17,482,861 (GRCm39) R180L probably benign Het
Gstt2 C A 10: 75,668,526 (GRCm39) R107L probably damaging Het
Hectd4 A T 5: 121,358,319 (GRCm39) probably benign Het
Helb A G 10: 119,938,791 (GRCm39) F561S probably damaging Het
Ints2 T C 11: 86,146,249 (GRCm39) T120A probably benign Het
Kdm5d G A Y: 914,056 (GRCm39) R331H probably benign Het
Limch1 A G 5: 67,159,825 (GRCm39) K418E probably damaging Het
Lrrc37 T A 11: 103,511,726 (GRCm39) T81S unknown Het
Med17 C T 9: 15,173,735 (GRCm39) probably null Het
Met A T 6: 17,571,799 (GRCm39) I1373F probably benign Het
Naip6 T A 13: 100,436,894 (GRCm39) Q543L possibly damaging Het
Nat9 T C 11: 115,075,902 (GRCm39) T40A probably damaging Het
Ogdh A G 11: 6,292,619 (GRCm39) N455S probably damaging Het
Or52k2 C A 7: 102,254,207 (GRCm39) F215L probably benign Het
Pde4a T C 9: 21,117,534 (GRCm39) F599L probably benign Het
Pga5 T C 19: 10,649,173 (GRCm39) Y249C probably damaging Het
Plekha8 A T 6: 54,607,539 (GRCm39) K382M probably damaging Het
Plekhd1 A T 12: 80,753,149 (GRCm39) E119V probably damaging Het
Pnp A T 14: 51,185,356 (GRCm39) H20L probably benign Het
Polq A T 16: 36,837,559 (GRCm39) probably null Het
Psma3 T G 12: 71,035,250 (GRCm39) I177R probably damaging Het
Ptpn3 A G 4: 57,240,784 (GRCm39) probably null Het
Ptprt A T 2: 161,400,806 (GRCm39) L1077Q probably damaging Het
Rbm47 A T 5: 66,184,573 (GRCm39) M10K possibly damaging Het
Rere A G 4: 150,703,653 (GRCm39) D186G probably damaging Het
Rpl24 T C 16: 55,787,453 (GRCm39) S38P probably damaging Het
Slco1a1 A T 6: 141,885,787 (GRCm39) F79L possibly damaging Het
Sorl1 T A 9: 41,903,041 (GRCm39) D1551V probably benign Het
Sos1 C A 17: 80,741,548 (GRCm39) M412I probably benign Het
Spast G A 17: 74,666,293 (GRCm39) V209I probably benign Het
Spindoc G T 19: 7,335,769 (GRCm39) Q340K possibly damaging Het
Tlr6 T C 5: 65,111,185 (GRCm39) Y574C probably damaging Het
Tnrc6a A G 7: 122,791,346 (GRCm39) N1748S possibly damaging Het
Trbv13-2 A T 6: 41,098,474 (GRCm39) K16N probably benign Het
Triobp C T 15: 78,878,326 (GRCm39) H1750Y possibly damaging Het
Ubc C T 5: 125,465,095 (GRCm39) M77I probably damaging Het
Usp24 A G 4: 106,225,933 (GRCm39) D659G possibly damaging Het
Vmn2r88 T A 14: 51,656,253 (GRCm39) C821S probably damaging Het
Whamm T A 7: 81,224,295 (GRCm39) V197D probably damaging Het
Zfp777 A G 6: 48,006,101 (GRCm39) F431S probably damaging Het
Other mutations in Krt6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Krt6b APN 15 101,588,267 (GRCm39) missense probably benign 0.22
IGL01653:Krt6b APN 15 101,587,549 (GRCm39) missense probably damaging 1.00
IGL01900:Krt6b APN 15 101,585,981 (GRCm39) missense possibly damaging 0.45
IGL03187:Krt6b APN 15 101,588,392 (GRCm39) missense probably benign
R0511:Krt6b UTSW 15 101,586,042 (GRCm39) splice site probably benign
R0788:Krt6b UTSW 15 101,585,954 (GRCm39) missense probably damaging 0.96
R1370:Krt6b UTSW 15 101,585,987 (GRCm39) missense probably damaging 0.96
R1481:Krt6b UTSW 15 101,586,809 (GRCm39) missense probably benign 0.05
R2007:Krt6b UTSW 15 101,586,562 (GRCm39) missense probably damaging 1.00
R2112:Krt6b UTSW 15 101,586,999 (GRCm39) missense possibly damaging 0.48
R2166:Krt6b UTSW 15 101,587,050 (GRCm39) critical splice acceptor site probably null
R2227:Krt6b UTSW 15 101,587,557 (GRCm39) missense probably damaging 0.96
R2495:Krt6b UTSW 15 101,586,757 (GRCm39) missense probably damaging 1.00
R2496:Krt6b UTSW 15 101,588,216 (GRCm39) missense probably damaging 1.00
R4726:Krt6b UTSW 15 101,586,520 (GRCm39) missense probably damaging 0.98
R4969:Krt6b UTSW 15 101,588,460 (GRCm39) missense possibly damaging 0.71
R6301:Krt6b UTSW 15 101,587,386 (GRCm39) missense probably damaging 1.00
R6646:Krt6b UTSW 15 101,585,649 (GRCm39) missense probably damaging 0.98
R7232:Krt6b UTSW 15 101,586,577 (GRCm39) missense probably damaging 1.00
R7406:Krt6b UTSW 15 101,587,513 (GRCm39) missense probably benign 0.04
R7414:Krt6b UTSW 15 101,587,449 (GRCm39) missense probably benign 0.05
R7849:Krt6b UTSW 15 101,587,009 (GRCm39) missense probably damaging 1.00
R8110:Krt6b UTSW 15 101,588,577 (GRCm39) missense probably damaging 0.96
R8448:Krt6b UTSW 15 101,586,455 (GRCm39) missense probably damaging 1.00
R8736:Krt6b UTSW 15 101,587,047 (GRCm39) missense probably damaging 1.00
R9466:Krt6b UTSW 15 101,586,027 (GRCm39) missense probably damaging 1.00
R9633:Krt6b UTSW 15 101,586,996 (GRCm39) missense probably benign 0.00
R9720:Krt6b UTSW 15 101,588,226 (GRCm39) missense probably benign 0.40
Z1177:Krt6b UTSW 15 101,586,767 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCATGGACCCCATTTATGG -3'
(R):5'- ATTGTGGCAATTTCTGTTCTCCAG -3'

Sequencing Primer
(F):5'- ATGGACCCCATTTATGGCAACTTTG -3'
(R):5'- GGAACTGTCTCAGATGCAAACTC -3'
Posted On 2020-09-02