Incidental Mutation 'R0033:Ctss'
ID64540
Institutional Source Beutler Lab
Gene Symbol Ctss
Ensembl Gene ENSMUSG00000038642
Gene Namecathepsin S
SynonymsCat S
MMRRC Submission 038327-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R0033 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location95526786-95556403 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 95545577 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015667] [ENSMUST00000116304]
PDB Structure
[]
MOUSE CATHEPSIN S WITH COVALENT LIGAND [X-RAY DIFFRACTION]
MOUSE CATHEPSIN S WITH COVALENT LIGAND [X-RAY DIFFRACTION]
MOUSE CATHEPSIN S WITH COVALENT LIGAND [X-RAY DIFFRACTION]
MOUSE CATHEPSIN S WITH COVALENT LIGAND [X-RAY DIFFRACTION]
MOUSE CATHEPSIN S WITH COVALENT LIGAND [X-RAY DIFFRACTION]
Mouse cathepsin s with covalent ligand (3S,4S)-N-[(2E)-2-IMINOETHYL]-4-(MORPHOLIN-4-YLCARBONYL)-1-(PHENYLSULFONYL)PYRROLIDINE-3-CARBOXAMIDE [X-RAY DIFFRACTION]
Mouse cathepsin s with covalent ligand (3S,4S)-1-[(2-CHLOROPHENYL)SULFONYL]-N-[(2E)-2-IMINOETHYL]-4-(MORPHOLIN-4-YLCARBONYL)PYRROLIDINE-3-CARBOXAMIDE [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000015667
SMART Domains Protein: ENSMUSP00000015667
Gene: ENSMUSG00000038642

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Inhibitor_I29 39 99 2.3e-27 SMART
Pept_C1 126 342 2.3e-122 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116304
SMART Domains Protein: ENSMUSP00000112006
Gene: ENSMUSG00000038642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Inhibitor_I29 36 96 3.01e-23 SMART
Pept_C1 123 339 6.79e-120 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 93.3%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase C1 (papain) family of cysteine proteases. Alternative splicing results in multiple transcript variants, which encode preproproteins that are proteolytically processed to generate mature protein products. This enzyme is secreted by antigen-presenting cells during inflammation and may induce pain and itch via activation of G-protein coupled receptors. Homozygous knockout mice for this gene exhibit impaired wound healing, reduced tumorigenesis in a pancreatic cancer model, and reduced pathogenesis in a myasthenia gravis model. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice are resistant to the development of experimental autoimmune myasthenia gravis and showed reduced T and B cell responses to acetylcholine receptor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik T C 1: 120,188,064 F110L probably damaging Het
Agr3 C T 12: 35,928,330 T14M possibly damaging Het
Ankib1 A C 5: 3,769,588 D110E possibly damaging Het
Auts2 G C 5: 131,440,093 D571E probably damaging Het
Cacna1d T A 14: 30,105,489 Q993L probably damaging Het
Cdkn3 C A 14: 46,768,872 Y141* probably null Het
Ceacam12 T G 7: 18,069,460 probably benign Het
Celf1 T C 2: 91,001,453 probably benign Het
Col6a3 A G 1: 90,802,245 S1780P probably damaging Het
Csf3r A G 4: 126,031,884 T151A probably benign Het
D430042O09Rik T G 7: 125,761,827 V103G possibly damaging Het
Emilin2 G T 17: 71,275,014 T239K probably benign Het
Erp44 T C 4: 48,241,289 probably benign Het
Fbxl4 T C 4: 22,377,017 V151A probably damaging Het
Fer1l4 G A 2: 156,024,106 probably benign Het
Gm12794 A T 4: 101,941,684 Y284F probably benign Het
Gm43302 T C 5: 105,276,844 D310G probably benign Het
Gstk1 A G 6: 42,246,803 probably benign Het
Hapln1 A T 13: 89,601,813 Q159L probably benign Het
Hibch A G 1: 52,905,451 K296R probably null Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kdm7a A T 6: 39,165,197 Y382* probably null Het
Kirrel3 A G 9: 35,000,963 I208V probably benign Het
Klc4 A T 17: 46,635,433 C489S probably damaging Het
Lrrc8a G T 2: 30,255,345 C57F probably damaging Het
Ltbp1 A G 17: 75,276,509 N435D possibly damaging Het
Macc1 T A 12: 119,446,341 N281K probably benign Het
Myo16 A T 8: 10,370,955 Y265F probably damaging Het
Myoc G A 1: 162,648,441 G238E probably damaging Het
Nlrp12 A C 7: 3,240,407 S492A probably damaging Het
Obscn A G 11: 58,994,746 probably benign Het
Olfr1413 A G 1: 92,573,260 T30A probably benign Het
Olfr486 G T 7: 108,171,927 D272E probably benign Het
Oplah T A 15: 76,297,134 Q1202L probably benign Het
Ppargc1b G A 18: 61,307,694 R718W probably damaging Het
Pwwp2b A T 7: 139,254,928 D95V possibly damaging Het
Rnf225 T C 7: 12,928,158 L88P probably damaging Het
Slc12a1 A G 2: 125,214,009 D820G probably benign Het
Slc12a4 G T 8: 105,947,479 probably benign Het
Slx4 C T 16: 3,988,000 A72T probably benign Het
Snrnp200 T C 2: 127,238,063 I1920T probably damaging Het
Stap2 C T 17: 55,999,976 V234M probably damaging Het
Sv2b A G 7: 75,117,741 F636L probably benign Het
Tdp1 C T 12: 99,935,052 T531I probably benign Het
Thra G A 11: 98,764,352 V353I probably benign Het
Tm7sf2 A G 19: 6,066,422 probably benign Het
Tmx4 A T 2: 134,600,998 probably null Het
Tnfrsf12a A G 17: 23,676,145 probably null Het
Trav6n-5 T A 14: 53,104,911 M14K probably benign Het
Ttn T A 2: 76,742,280 I26090F probably damaging Het
Tut1 G T 19: 8,962,759 R369L probably benign Het
Uba5 T A 9: 104,054,148 T241S probably benign Het
Unc13d T C 11: 116,069,165 T597A probably benign Het
Vmn1r58 A T 7: 5,410,388 I281K probably damaging Het
Vmn1r59 A G 7: 5,454,434 V109A probably benign Het
Xdh T A 17: 73,907,632 M773L probably benign Het
Zfp64 A T 2: 168,925,715 I659N possibly damaging Het
Other mutations in Ctss
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Ctss APN 3 95538725 missense probably damaging 1.00
IGL02162:Ctss APN 3 95546821 missense probably benign 0.26
IGL03026:Ctss APN 3 95538830 missense probably benign 0.01
IGL03219:Ctss APN 3 95543100 missense possibly damaging 0.88
clip UTSW 3 95545384 nonsense probably null
R0025:Ctss UTSW 3 95550137 missense probably damaging 1.00
R0025:Ctss UTSW 3 95550137 missense probably damaging 1.00
R0033:Ctss UTSW 3 95545577 splice site probably benign
R1844:Ctss UTSW 3 95546794 critical splice acceptor site probably null
R2866:Ctss UTSW 3 95545406 missense probably benign 0.04
R4061:Ctss UTSW 3 95543034 missense probably benign 0.34
R4846:Ctss UTSW 3 95545384 nonsense probably null
R5917:Ctss UTSW 3 95543113 missense probably benign 0.00
R6443:Ctss UTSW 3 95546803 missense probably benign 0.00
R6555:Ctss UTSW 3 95543029 nonsense probably null
R7391:Ctss UTSW 3 95529541 missense probably benign
R8007:Ctss UTSW 3 95550154 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- ACTGATCCCGGACGGATTCTTCTC -3'
(R):5'- TCACCTGGAAATATCACTGGGCATTG -3'

Sequencing Primer
(F):5'- TGAAAACGGGGAAGCTGATATCC -3'
(R):5'- ttggaaggtaaggcaggaag -3'
Posted On2013-08-06