Incidental Mutation 'R8349:Gtf3c3'
ID645403
Institutional Source Beutler Lab
Gene Symbol Gtf3c3
Ensembl Gene ENSMUSG00000041303
Gene Namegeneral transcription factor IIIC, polypeptide 3
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R8349 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location54396004-54438971 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 54428909 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 190 (E190K)
Ref Sequence ENSEMBL: ENSMUSP00000039420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041638]
Predicted Effect probably damaging
Transcript: ENSMUST00000041638
AA Change: E190K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039420
Gene: ENSMUSG00000041303
AA Change: E190K

DomainStartEndE-ValueType
low complexity region 18 34 N/A INTRINSIC
low complexity region 92 108 N/A INTRINSIC
TPR 145 178 9.24e1 SMART
TPR 179 212 2.36e1 SMART
TPR 213 246 4.58e-4 SMART
TPR 247 280 6.4e1 SMART
Blast:TPR 286 319 6e-9 BLAST
low complexity region 353 365 N/A INTRINSIC
TPR 452 485 1.87e1 SMART
low complexity region 549 560 N/A INTRINSIC
TPR 807 840 3.27e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the TFIIIC2 complex, which binds to the promoters of small nuclear and cytoplasmic RNA genes in order to recruit RNA polymerase III. The TFIIIC2 complex is composed of six subunits. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace3 A G 11: 105,994,942 E58G probably damaging Het
Ank1 T A 8: 23,139,286 F4I possibly damaging Het
Arih2 T C 9: 108,611,673 D282G possibly damaging Het
Atp7b C T 8: 22,013,540 V733I probably damaging Het
Avil A G 10: 127,009,992 D370G probably benign Het
Ccdc88b T C 19: 6,855,845 E278G probably damaging Het
Cdkl3 A G 11: 52,084,433 H74R Het
Clec9a C A 6: 129,410,329 A49E probably damaging Het
Cntn5 A G 9: 9,666,835 probably null Het
Cyp11b2 A G 15: 74,851,579 M412T possibly damaging Het
Dync1i1 A G 6: 5,966,815 Q399R possibly damaging Het
Fam47e C A 5: 92,555,131 R21S probably benign Het
Gimap4 A G 6: 48,690,760 I150V probably damaging Het
Gm4756 T C 12: 72,612,566 N145D probably damaging Het
Gm7361 T A 5: 26,260,389 M128K possibly damaging Het
Hells T C 19: 38,951,842 S396P probably damaging Het
Hrg T A 16: 22,961,536 S521R unknown Het
Itih5 A G 2: 10,186,989 T112A probably benign Het
Ly9 T A 1: 171,594,018 N555I probably damaging Het
Morc2b C T 17: 33,136,801 E666K probably benign Het
Mup8 C A 4: 60,222,382 V30L probably benign Het
Nebl T A 2: 17,413,782 E268D probably damaging Het
Nr4a3 G T 4: 48,052,170 R308L probably benign Het
Olfr1080 T G 2: 86,553,636 I163L probably benign Het
Olfr125 A G 17: 37,835,670 R224G probably damaging Het
Olfr1258 A T 2: 89,930,534 I242L possibly damaging Het
Olfr214 G T 6: 116,557,328 R301L probably damaging Het
Olfr370 A T 8: 83,541,672 H176L probably damaging Het
Plcd3 A G 11: 103,074,670 Y530H probably damaging Het
Pou2af1 A T 9: 51,233,026 E80V probably damaging Het
Scgb2b18 C T 7: 33,173,231 D50N probably benign Het
Sis C T 3: 72,903,651 G1679D probably damaging Het
Sorcs2 A T 5: 36,229,175 M173K possibly damaging Het
Ston2 T C 12: 91,641,875 D817G probably damaging Het
Ticrr T A 7: 79,694,680 F1431Y probably benign Het
Uevld T A 7: 46,945,307 N179I probably damaging Het
Utp6 G T 11: 79,945,784 Q375K probably benign Het
Vmn2r68 T A 7: 85,233,577 E322D probably damaging Het
Wnt5a A G 14: 28,513,151 M51V probably benign Het
Zfp202 A T 9: 40,207,680 R130* probably null Het
Zfp949 G T 9: 88,567,249 V36L possibly damaging Het
Other mutations in Gtf3c3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Gtf3c3 APN 1 54415955 missense probably damaging 0.99
IGL00435:Gtf3c3 APN 1 54427535 missense possibly damaging 0.73
IGL01128:Gtf3c3 APN 1 54428876 missense possibly damaging 0.91
R0243:Gtf3c3 UTSW 1 54403536 missense possibly damaging 0.60
R0271:Gtf3c3 UTSW 1 54428812 missense possibly damaging 0.96
R0571:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R0965:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R0968:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1069:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1070:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1111:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1112:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1113:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1114:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1115:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1117:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1118:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1119:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1228:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1230:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1231:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1313:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1313:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1382:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1394:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1395:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1397:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1414:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1430:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1432:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1473:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1497:Gtf3c3 UTSW 1 54437939 missense probably benign
R1556:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1563:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1638:Gtf3c3 UTSW 1 54405119 missense probably damaging 1.00
R1695:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1716:Gtf3c3 UTSW 1 54399260 missense probably damaging 1.00
R1745:Gtf3c3 UTSW 1 54434212 missense probably damaging 1.00
R1767:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1799:Gtf3c3 UTSW 1 54420424 missense possibly damaging 0.82
R1861:Gtf3c3 UTSW 1 54438838 missense possibly damaging 0.87
R1940:Gtf3c3 UTSW 1 54428958 splice site probably benign
R3804:Gtf3c3 UTSW 1 54424007 critical splice donor site probably null
R4496:Gtf3c3 UTSW 1 54424132 missense probably benign 0.03
R4621:Gtf3c3 UTSW 1 54419416 missense probably damaging 1.00
R5131:Gtf3c3 UTSW 1 54419498 splice site probably null
R5320:Gtf3c3 UTSW 1 54405873 missense probably damaging 1.00
R5605:Gtf3c3 UTSW 1 54415926 missense probably benign 0.06
R5854:Gtf3c3 UTSW 1 54419437 missense probably benign 0.01
R6050:Gtf3c3 UTSW 1 54406070 missense probably benign 0.00
R6441:Gtf3c3 UTSW 1 54406038 missense probably benign 0.03
R6892:Gtf3c3 UTSW 1 54415941 missense probably benign 0.00
R7114:Gtf3c3 UTSW 1 54423507 missense probably benign
R7299:Gtf3c3 UTSW 1 54417708 missense probably benign 0.01
R7441:Gtf3c3 UTSW 1 54420448 missense probably benign 0.00
R7586:Gtf3c3 UTSW 1 54403593 missense probably damaging 1.00
R7615:Gtf3c3 UTSW 1 54423572 missense possibly damaging 0.49
R7634:Gtf3c3 UTSW 1 54419641 splice site probably null
R7739:Gtf3c3 UTSW 1 54405039 missense possibly damaging 0.94
R8449:Gtf3c3 UTSW 1 54428909 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTACTAATGACCCATTGTGTAACACC -3'
(R):5'- AGGTAGCAAGAGTCCATCCC -3'

Sequencing Primer
(F):5'- ACCCATTGTGTAACACCTAATAAAAC -3'
(R):5'- ACCAGCTTAAGCCTATTCT -3'
Posted On2020-09-02