Incidental Mutation 'R8349:Itih5'
ID 645405
Institutional Source Beutler Lab
Gene Symbol Itih5
Ensembl Gene ENSMUSG00000025780
Gene Name inter-alpha-trypsin inhibitor, heavy chain 5
Synonyms 4631408O11Rik, 5430408M01Rik
MMRRC Submission 067803-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R8349 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 10158382-10261340 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 10191800 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 112 (T112A)
Ref Sequence ENSEMBL: ENSMUSP00000026886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026886]
AlphaFold Q8BJD1
Predicted Effect probably benign
Transcript: ENSMUST00000026886
AA Change: T112A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000026886
Gene: ENSMUSG00000025780
AA Change: T112A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 30 45 N/A INTRINSIC
Pfam:VIT 51 159 5.5e-27 PFAM
VWA 293 476 5.84e-24 SMART
Pfam:ITI_HC_C 716 909 1.7e-60 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heavy chain component of one of the inter-alpha-trypsin inhibitor (ITI) family members. ITI proteins are involved in extracellular matrix stabilization and in the prevention of tumor metastasis. They are also structurally related plasma serine protease inhibitors and are composed of a light chain and varying numbers of heavy chains. This family member is thought to function as a tumor suppressor in breast and thyroid cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace3 A G 11: 105,885,768 (GRCm39) E58G probably damaging Het
Ank1 T A 8: 23,629,302 (GRCm39) F4I possibly damaging Het
Arih2 T C 9: 108,488,872 (GRCm39) D282G possibly damaging Het
Atp7b C T 8: 22,503,556 (GRCm39) V733I probably damaging Het
Avil A G 10: 126,845,861 (GRCm39) D370G probably benign Het
Ccdc88b T C 19: 6,833,213 (GRCm39) E278G probably damaging Het
Cdkl3 A G 11: 51,975,260 (GRCm39) H74R Het
Clec9a C A 6: 129,387,292 (GRCm39) A49E probably damaging Het
Cntn5 A G 9: 9,666,840 (GRCm39) probably null Het
Cyp11b2 A G 15: 74,723,428 (GRCm39) M412T possibly damaging Het
Dhrs7l T C 12: 72,659,340 (GRCm39) N145D probably damaging Het
Dync1i1 A G 6: 5,966,815 (GRCm39) Q399R possibly damaging Het
Fam47e C A 5: 92,702,990 (GRCm39) R21S probably benign Het
Gimap4 A G 6: 48,667,694 (GRCm39) I150V probably damaging Het
Gm7361 T A 5: 26,465,387 (GRCm39) M128K possibly damaging Het
Gtf3c3 C T 1: 54,468,068 (GRCm39) E190K probably damaging Het
Hells T C 19: 38,940,286 (GRCm39) S396P probably damaging Het
Hrg T A 16: 22,780,286 (GRCm39) S521R unknown Het
Ly9 T A 1: 171,421,586 (GRCm39) N555I probably damaging Het
Morc2b C T 17: 33,355,775 (GRCm39) E666K probably benign Het
Mup8 C A 4: 60,222,382 (GRCm39) V30L probably benign Het
Nebl T A 2: 17,418,593 (GRCm39) E268D probably damaging Het
Nr4a3 G T 4: 48,052,170 (GRCm39) R308L probably benign Het
Or10k2 A T 8: 84,268,301 (GRCm39) H176L probably damaging Het
Or14j1 A G 17: 38,146,561 (GRCm39) R224G probably damaging Het
Or4c10 A T 2: 89,760,878 (GRCm39) I242L possibly damaging Het
Or6d14 G T 6: 116,534,289 (GRCm39) R301L probably damaging Het
Or8k33 T G 2: 86,383,980 (GRCm39) I163L probably benign Het
Plcd3 A G 11: 102,965,496 (GRCm39) Y530H probably damaging Het
Pou2af1 A T 9: 51,144,326 (GRCm39) E80V probably damaging Het
Scgb2b18 C T 7: 32,872,656 (GRCm39) D50N probably benign Het
Sis C T 3: 72,810,984 (GRCm39) G1679D probably damaging Het
Sorcs2 A T 5: 36,386,519 (GRCm39) M173K possibly damaging Het
Ston2 T C 12: 91,608,649 (GRCm39) D817G probably damaging Het
Ticrr T A 7: 79,344,428 (GRCm39) F1431Y probably benign Het
Uevld T A 7: 46,595,055 (GRCm39) N179I probably damaging Het
Utp6 G T 11: 79,836,610 (GRCm39) Q375K probably benign Het
Vmn2r68 T A 7: 84,882,785 (GRCm39) E322D probably damaging Het
Wnt5a A G 14: 28,235,108 (GRCm39) M51V probably benign Het
Zfp202 A T 9: 40,118,976 (GRCm39) R130* probably null Het
Zfp949 G T 9: 88,449,302 (GRCm39) V36L possibly damaging Het
Other mutations in Itih5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Itih5 APN 2 10,195,100 (GRCm39) missense probably damaging 1.00
IGL02125:Itih5 APN 2 10,245,798 (GRCm39) missense probably benign
IGL02370:Itih5 APN 2 10,191,786 (GRCm39) missense probably benign 0.05
IGL03376:Itih5 APN 2 10,211,584 (GRCm39) missense probably benign 0.12
IGL02991:Itih5 UTSW 2 10,256,162 (GRCm39) missense probably benign 0.01
R0090:Itih5 UTSW 2 10,169,495 (GRCm39) missense probably benign 0.03
R0096:Itih5 UTSW 2 10,256,189 (GRCm39) missense probably benign 0.02
R0096:Itih5 UTSW 2 10,256,189 (GRCm39) missense probably benign 0.02
R0158:Itih5 UTSW 2 10,239,803 (GRCm39) splice site probably benign
R0270:Itih5 UTSW 2 10,256,075 (GRCm39) missense probably benign 0.38
R0276:Itih5 UTSW 2 10,190,375 (GRCm39) missense possibly damaging 0.80
R0807:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R0810:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R0903:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R0905:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R0906:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R1104:Itih5 UTSW 2 10,256,323 (GRCm39) missense probably benign 0.03
R1397:Itih5 UTSW 2 10,245,618 (GRCm39) missense probably benign 0.14
R1671:Itih5 UTSW 2 10,191,782 (GRCm39) missense probably benign 0.03
R1971:Itih5 UTSW 2 10,243,379 (GRCm39) missense probably damaging 1.00
R3684:Itih5 UTSW 2 10,243,435 (GRCm39) missense possibly damaging 0.93
R3685:Itih5 UTSW 2 10,243,435 (GRCm39) missense possibly damaging 0.93
R3831:Itih5 UTSW 2 10,256,081 (GRCm39) missense possibly damaging 0.95
R3934:Itih5 UTSW 2 10,250,355 (GRCm39) missense probably damaging 0.98
R4670:Itih5 UTSW 2 10,195,180 (GRCm39) missense probably benign 0.01
R4803:Itih5 UTSW 2 10,245,392 (GRCm39) missense probably benign
R4950:Itih5 UTSW 2 10,239,892 (GRCm39) missense probably damaging 0.98
R5020:Itih5 UTSW 2 10,245,315 (GRCm39) splice site probably null
R5735:Itih5 UTSW 2 10,245,572 (GRCm39) missense probably benign 0.00
R6454:Itih5 UTSW 2 10,245,479 (GRCm39) missense probably benign
R6662:Itih5 UTSW 2 10,253,992 (GRCm39) missense probably benign 0.13
R7019:Itih5 UTSW 2 10,195,138 (GRCm39) missense probably damaging 1.00
R7068:Itih5 UTSW 2 10,254,115 (GRCm39) missense probably damaging 0.99
R7246:Itih5 UTSW 2 10,191,873 (GRCm39) splice site probably null
R7424:Itih5 UTSW 2 10,250,448 (GRCm39) missense probably damaging 1.00
R7452:Itih5 UTSW 2 10,243,607 (GRCm39) missense probably damaging 1.00
R7597:Itih5 UTSW 2 10,254,187 (GRCm39) missense probably damaging 1.00
R8025:Itih5 UTSW 2 10,245,833 (GRCm39) missense probably benign 0.13
R8253:Itih5 UTSW 2 10,243,406 (GRCm39) missense probably benign 0.06
R8439:Itih5 UTSW 2 10,239,869 (GRCm39) missense probably benign 0.19
R8449:Itih5 UTSW 2 10,191,800 (GRCm39) missense probably benign 0.01
R8825:Itih5 UTSW 2 10,195,231 (GRCm39) missense probably benign 0.00
R9110:Itih5 UTSW 2 10,191,831 (GRCm39) missense probably benign
R9582:Itih5 UTSW 2 10,195,013 (GRCm39) missense probably benign 0.07
R9744:Itih5 UTSW 2 10,256,221 (GRCm39) missense probably damaging 1.00
X0026:Itih5 UTSW 2 10,243,370 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- TGATACTTCAAGGCTGGTGCTG -3'
(R):5'- ACCCTTTCAATGGAAGAGTAGAG -3'

Sequencing Primer
(F):5'- TGCTGAGTGTGGAATGCAC -3'
(R):5'- AGAGGCAGGAATAGGTCTTTGTGTAC -3'
Posted On 2020-09-02