Incidental Mutation 'R8349:Zfp949'
ID645429
Institutional Source Beutler Lab
Gene Symbol Zfp949
Ensembl Gene ENSMUSG00000032425
Gene Namezinc finger protein 949
Synonyms4930422I07Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R8349 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location88548020-88571061 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 88567249 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 36 (V36L)
Ref Sequence ENSEMBL: ENSMUSP00000125017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160652] [ENSMUST00000161458] [ENSMUST00000162827]
Predicted Effect probably benign
Transcript: ENSMUST00000160652
AA Change: V36L

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect possibly damaging
Transcript: ENSMUST00000161458
AA Change: V36L

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125017
Gene: ENSMUSG00000032425
AA Change: V36L

DomainStartEndE-ValueType
KRAB 8 68 2.63e-32 SMART
ZnF_C2H2 268 290 5.99e1 SMART
ZnF_C2H2 296 318 5.5e-3 SMART
ZnF_C2H2 324 346 6.42e-4 SMART
ZnF_C2H2 352 374 2.91e-2 SMART
ZnF_C2H2 380 402 4.11e-2 SMART
ZnF_C2H2 408 430 3.63e-3 SMART
ZnF_C2H2 436 458 5.67e-5 SMART
ZnF_C2H2 464 486 7.9e-4 SMART
ZnF_C2H2 492 514 2.43e-4 SMART
ZnF_C2H2 520 542 2.95e-3 SMART
ZnF_C2H2 548 570 1.03e-2 SMART
ZnF_C2H2 576 598 1.4e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000162827
AA Change: V36L

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125325
Gene: ENSMUSG00000032425
AA Change: V36L

DomainStartEndE-ValueType
KRAB 8 68 2.63e-32 SMART
ZnF_C2H2 268 290 5.99e1 SMART
ZnF_C2H2 296 318 5.5e-3 SMART
ZnF_C2H2 324 346 6.42e-4 SMART
ZnF_C2H2 352 374 2.91e-2 SMART
ZnF_C2H2 380 402 4.11e-2 SMART
ZnF_C2H2 408 430 3.63e-3 SMART
ZnF_C2H2 436 458 5.67e-5 SMART
ZnF_C2H2 464 486 7.9e-4 SMART
ZnF_C2H2 492 514 2.43e-4 SMART
ZnF_C2H2 520 542 2.95e-3 SMART
ZnF_C2H2 548 570 1.03e-2 SMART
ZnF_C2H2 576 598 1.4e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality during organogenesis with defects in growth, development, cell proliferation, apoptosis and turning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace3 A G 11: 105,994,942 E58G probably damaging Het
Ank1 T A 8: 23,139,286 F4I possibly damaging Het
Arih2 T C 9: 108,611,673 D282G possibly damaging Het
Atp7b C T 8: 22,013,540 V733I probably damaging Het
Avil A G 10: 127,009,992 D370G probably benign Het
Ccdc88b T C 19: 6,855,845 E278G probably damaging Het
Cdkl3 A G 11: 52,084,433 H74R Het
Clec9a C A 6: 129,410,329 A49E probably damaging Het
Cntn5 A G 9: 9,666,835 probably null Het
Cyp11b2 A G 15: 74,851,579 M412T possibly damaging Het
Dync1i1 A G 6: 5,966,815 Q399R possibly damaging Het
Fam47e C A 5: 92,555,131 R21S probably benign Het
Gimap4 A G 6: 48,690,760 I150V probably damaging Het
Gm4756 T C 12: 72,612,566 N145D probably damaging Het
Gm7361 T A 5: 26,260,389 M128K possibly damaging Het
Gtf3c3 C T 1: 54,428,909 E190K probably damaging Het
Hells T C 19: 38,951,842 S396P probably damaging Het
Hrg T A 16: 22,961,536 S521R unknown Het
Itih5 A G 2: 10,186,989 T112A probably benign Het
Ly9 T A 1: 171,594,018 N555I probably damaging Het
Morc2b C T 17: 33,136,801 E666K probably benign Het
Mup8 C A 4: 60,222,382 V30L probably benign Het
Nebl T A 2: 17,413,782 E268D probably damaging Het
Nr4a3 G T 4: 48,052,170 R308L probably benign Het
Olfr1080 T G 2: 86,553,636 I163L probably benign Het
Olfr125 A G 17: 37,835,670 R224G probably damaging Het
Olfr1258 A T 2: 89,930,534 I242L possibly damaging Het
Olfr214 G T 6: 116,557,328 R301L probably damaging Het
Olfr370 A T 8: 83,541,672 H176L probably damaging Het
Plcd3 A G 11: 103,074,670 Y530H probably damaging Het
Pou2af1 A T 9: 51,233,026 E80V probably damaging Het
Scgb2b18 C T 7: 33,173,231 D50N probably benign Het
Sis C T 3: 72,903,651 G1679D probably damaging Het
Sorcs2 A T 5: 36,229,175 M173K possibly damaging Het
Ston2 T C 12: 91,641,875 D817G probably damaging Het
Ticrr T A 7: 79,694,680 F1431Y probably benign Het
Uevld T A 7: 46,945,307 N179I probably damaging Het
Utp6 G T 11: 79,945,784 Q375K probably benign Het
Vmn2r68 T A 7: 85,233,577 E322D probably damaging Het
Wnt5a A G 14: 28,513,151 M51V probably benign Het
Zfp202 A T 9: 40,207,680 R130* probably null Het
Other mutations in Zfp949
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03201:Zfp949 APN 9 88568664 missense probably benign 0.23
R0034:Zfp949 UTSW 9 88567640 intron probably benign
R0462:Zfp949 UTSW 9 88568734 missense possibly damaging 0.63
R1457:Zfp949 UTSW 9 88569838 missense probably damaging 1.00
R1574:Zfp949 UTSW 9 88569777 nonsense probably null
R1574:Zfp949 UTSW 9 88569777 nonsense probably null
R1878:Zfp949 UTSW 9 88569303 missense probably damaging 0.99
R1917:Zfp949 UTSW 9 88570062 missense probably damaging 0.98
R4488:Zfp949 UTSW 9 88570089 missense probably damaging 0.98
R4839:Zfp949 UTSW 9 88569994 missense probably damaging 0.97
R5309:Zfp949 UTSW 9 88567183 missense possibly damaging 0.92
R5312:Zfp949 UTSW 9 88567183 missense possibly damaging 0.92
R5461:Zfp949 UTSW 9 88569484 missense probably benign 0.00
R6530:Zfp949 UTSW 9 88567287 critical splice donor site probably null
R6844:Zfp949 UTSW 9 88569411 missense possibly damaging 0.91
R7749:Zfp949 UTSW 9 88569870 missense probably damaging 1.00
R7937:Zfp949 UTSW 9 88569270 missense probably damaging 1.00
R8150:Zfp949 UTSW 9 88570000 missense probably benign
R8290:Zfp949 UTSW 9 88569240 missense probably damaging 0.98
R8449:Zfp949 UTSW 9 88567249 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- TGCAAAATACACATGAGAGCCTTC -3'
(R):5'- GGTTTAGGGATGCATTGCCC -3'

Sequencing Primer
(F):5'- CTGTTACAGGAGTTGgtg -3'
(R):5'- AGGGATGCATTGCCCTGTTAATAG -3'
Posted On2020-09-02