Incidental Mutation 'R8349:Hrg'
ID645440
Institutional Source Beutler Lab
Gene Symbol Hrg
Ensembl Gene ENSMUSG00000022877
Gene Namehistidine-rich glycoprotein
SynonymsD18020, D16JH2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.310) question?
Stock #R8349 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location22951072-22961656 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 22961536 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 521 (S521R)
Ref Sequence ENSEMBL: ENSMUSP00000023590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023590] [ENSMUST00000232422]
Predicted Effect unknown
Transcript: ENSMUST00000023590
AA Change: S521R
SMART Domains Protein: ENSMUSP00000023590
Gene: ENSMUSG00000022877
AA Change: S521R

DomainStartEndE-ValueType
CY 22 133 8.98e-4 SMART
CY 146 251 1.3e-2 SMART
low complexity region 347 417 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000232422
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display mild monocytosis, decreased bleeding time, faster clot lysis, and abnormal blood coagulation; however, wound healing is normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace3 A G 11: 105,994,942 E58G probably damaging Het
Ank1 T A 8: 23,139,286 F4I possibly damaging Het
Arih2 T C 9: 108,611,673 D282G possibly damaging Het
Atp7b C T 8: 22,013,540 V733I probably damaging Het
Avil A G 10: 127,009,992 D370G probably benign Het
Ccdc88b T C 19: 6,855,845 E278G probably damaging Het
Cdkl3 A G 11: 52,084,433 H74R Het
Clec9a C A 6: 129,410,329 A49E probably damaging Het
Cntn5 A G 9: 9,666,835 probably null Het
Cyp11b2 A G 15: 74,851,579 M412T possibly damaging Het
Dync1i1 A G 6: 5,966,815 Q399R possibly damaging Het
Fam47e C A 5: 92,555,131 R21S probably benign Het
Gimap4 A G 6: 48,690,760 I150V probably damaging Het
Gm4756 T C 12: 72,612,566 N145D probably damaging Het
Gm7361 T A 5: 26,260,389 M128K possibly damaging Het
Gtf3c3 C T 1: 54,428,909 E190K probably damaging Het
Hells T C 19: 38,951,842 S396P probably damaging Het
Itih5 A G 2: 10,186,989 T112A probably benign Het
Ly9 T A 1: 171,594,018 N555I probably damaging Het
Morc2b C T 17: 33,136,801 E666K probably benign Het
Mup8 C A 4: 60,222,382 V30L probably benign Het
Nebl T A 2: 17,413,782 E268D probably damaging Het
Nr4a3 G T 4: 48,052,170 R308L probably benign Het
Olfr1080 T G 2: 86,553,636 I163L probably benign Het
Olfr125 A G 17: 37,835,670 R224G probably damaging Het
Olfr1258 A T 2: 89,930,534 I242L possibly damaging Het
Olfr214 G T 6: 116,557,328 R301L probably damaging Het
Olfr370 A T 8: 83,541,672 H176L probably damaging Het
Plcd3 A G 11: 103,074,670 Y530H probably damaging Het
Pou2af1 A T 9: 51,233,026 E80V probably damaging Het
Scgb2b18 C T 7: 33,173,231 D50N probably benign Het
Sis C T 3: 72,903,651 G1679D probably damaging Het
Sorcs2 A T 5: 36,229,175 M173K possibly damaging Het
Ston2 T C 12: 91,641,875 D817G probably damaging Het
Ticrr T A 7: 79,694,680 F1431Y probably benign Het
Uevld T A 7: 46,945,307 N179I probably damaging Het
Utp6 G T 11: 79,945,784 Q375K probably benign Het
Vmn2r68 T A 7: 85,233,577 E322D probably damaging Het
Wnt5a A G 14: 28,513,151 M51V probably benign Het
Zfp202 A T 9: 40,207,680 R130* probably null Het
Zfp949 G T 9: 88,567,249 V36L possibly damaging Het
Other mutations in Hrg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Hrg APN 16 22959159 critical splice acceptor site probably null
IGL02795:Hrg APN 16 22957553 unclassified probably benign
R0042:Hrg UTSW 16 22961136 unclassified probably benign
R0184:Hrg UTSW 16 22953771 critical splice donor site probably null
R1147:Hrg UTSW 16 22961004 missense probably damaging 0.99
R1147:Hrg UTSW 16 22961004 missense probably damaging 0.99
R1733:Hrg UTSW 16 22951247 missense probably damaging 1.00
R1828:Hrg UTSW 16 22956103 missense probably damaging 1.00
R1919:Hrg UTSW 16 22954457 missense probably damaging 1.00
R2104:Hrg UTSW 16 22956199 missense probably benign 0.09
R2281:Hrg UTSW 16 22961309 unclassified probably benign
R2447:Hrg UTSW 16 22961148 unclassified probably benign
R3962:Hrg UTSW 16 22956075 missense possibly damaging 0.85
R3963:Hrg UTSW 16 22956075 missense possibly damaging 0.85
R4571:Hrg UTSW 16 22961222 unclassified probably benign
R4903:Hrg UTSW 16 22961151 unclassified probably benign
R4904:Hrg UTSW 16 22951250 missense probably benign 0.03
R5236:Hrg UTSW 16 22961513 unclassified probably benign
R6020:Hrg UTSW 16 22954518 missense probably damaging 1.00
R6054:Hrg UTSW 16 22953662 missense probably benign 0.05
R6207:Hrg UTSW 16 22954538 critical splice donor site probably null
R6374:Hrg UTSW 16 22960992 missense probably damaging 0.98
R7516:Hrg UTSW 16 22961298 missense unknown
R7606:Hrg UTSW 16 22951123 start codon destroyed probably null 0.01
R8190:Hrg UTSW 16 22961043 missense unknown
R8449:Hrg UTSW 16 22961536 missense unknown
Z1177:Hrg UTSW 16 22953712 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCGGGGCTATGGTCCACC -3'
(R):5'- GCCCATCTGTCTCATTCTGG -3'

Sequencing Primer
(F):5'- TCCAGGCAAAGGACTCTTTC -3'
(R):5'- GGCTTCTTTCCCATACTTCCCTATG -3'
Posted On2020-09-02