Incidental Mutation 'R0033:Auts2'
ID64545
Institutional Source Beutler Lab
Gene Symbol Auts2
Ensembl Gene ENSMUSG00000029673
Gene Nameautism susceptibility candidate 2
SynonymsD830032G16Rik, 2700063G02Rik, A730011F23Rik
MMRRC Submission 038327-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0033 (G1)
Quality Score85
Status Validated
Chromosome5
Chromosomal Location131437333-132543344 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 131440093 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 571 (D571E)
Ref Sequence ENSEMBL: ENSMUSP00000124730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161374] [ENSMUST00000161804] [ENSMUST00000187544]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160071
SMART Domains Protein: ENSMUSP00000125349
Gene: ENSMUSG00000029673

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 67 84 N/A INTRINSIC
low complexity region 92 105 N/A INTRINSIC
Pfam:Auts2 194 406 2.3e-108 PFAM
low complexity region 433 446 N/A INTRINSIC
low complexity region 555 565 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 763 779 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161226
SMART Domains Protein: ENSMUSP00000124900
Gene: ENSMUSG00000029673

DomainStartEndE-ValueType
low complexity region 11 45 N/A INTRINSIC
low complexity region 62 82 N/A INTRINSIC
low complexity region 133 150 N/A INTRINSIC
low complexity region 199 214 N/A INTRINSIC
low complexity region 297 315 N/A INTRINSIC
low complexity region 330 355 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161374
AA Change: D571E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124730
Gene: ENSMUSG00000029673
AA Change: D571E

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 67 84 N/A INTRINSIC
low complexity region 92 105 N/A INTRINSIC
Pfam:Auts2 172 384 1.5e-112 PFAM
low complexity region 411 424 N/A INTRINSIC
low complexity region 533 543 N/A INTRINSIC
low complexity region 599 614 N/A INTRINSIC
low complexity region 741 757 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161804
AA Change: D586E

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000124027
Gene: ENSMUSG00000029673
AA Change: D586E

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 67 84 N/A INTRINSIC
low complexity region 92 105 N/A INTRINSIC
Pfam:Auts2 187 399 3.9e-113 PFAM
low complexity region 426 439 N/A INTRINSIC
low complexity region 548 558 N/A INTRINSIC
low complexity region 614 629 N/A INTRINSIC
low complexity region 756 772 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162101
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182575
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182974
Predicted Effect probably benign
Transcript: ENSMUST00000187544
AA Change: D795E

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000139759
Gene: ENSMUSG00000029673
AA Change: D795E

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 83 125 N/A INTRINSIC
low complexity region 127 161 N/A INTRINSIC
low complexity region 168 183 N/A INTRINSIC
low complexity region 212 224 N/A INTRINSIC
low complexity region 276 293 N/A INTRINSIC
low complexity region 301 314 N/A INTRINSIC
Pfam:Auts2 396 608 4.3e-109 PFAM
low complexity region 635 648 N/A INTRINSIC
low complexity region 757 767 N/A INTRINSIC
low complexity region 823 838 N/A INTRINSIC
low complexity region 965 981 N/A INTRINSIC
Meta Mutation Damage Score 0.0604 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 93.3%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene has been implicated in neurodevelopment and as a candidate gene for numerous neurological disorders, including autism spectrum disorders, intellectual disability, and developmental delay. Mutations in this gene have also been associated with non-neurological disorders, such as acute lymphoblastic leukemia, aging of the skin, early-onset androgenetic alopecia, and certain cancers. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a brain-specific knockout are smaller than controls, and exhibit behavioral defects such as less vocalizations, impairments in righting response and geotaxis, and decreased food intake. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik T C 1: 120,188,064 F110L probably damaging Het
Agr3 C T 12: 35,928,330 T14M possibly damaging Het
Ankib1 A C 5: 3,769,588 D110E possibly damaging Het
Cacna1d T A 14: 30,105,489 Q993L probably damaging Het
Cdkn3 C A 14: 46,768,872 Y141* probably null Het
Ceacam12 T G 7: 18,069,460 probably benign Het
Celf1 T C 2: 91,001,453 probably benign Het
Col6a3 A G 1: 90,802,245 S1780P probably damaging Het
Csf3r A G 4: 126,031,884 T151A probably benign Het
Ctss G A 3: 95,545,577 probably benign Het
D430042O09Rik T G 7: 125,761,827 V103G possibly damaging Het
Emilin2 G T 17: 71,275,014 T239K probably benign Het
Erp44 T C 4: 48,241,289 probably benign Het
Fbxl4 T C 4: 22,377,017 V151A probably damaging Het
Fer1l4 G A 2: 156,024,106 probably benign Het
Gm12794 A T 4: 101,941,684 Y284F probably benign Het
Gm43302 T C 5: 105,276,844 D310G probably benign Het
Gstk1 A G 6: 42,246,803 probably benign Het
Hapln1 A T 13: 89,601,813 Q159L probably benign Het
Hibch A G 1: 52,905,451 K296R probably null Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kdm7a A T 6: 39,165,197 Y382* probably null Het
Kirrel3 A G 9: 35,000,963 I208V probably benign Het
Klc4 A T 17: 46,635,433 C489S probably damaging Het
Lrrc8a G T 2: 30,255,345 C57F probably damaging Het
Ltbp1 A G 17: 75,276,509 N435D possibly damaging Het
Macc1 T A 12: 119,446,341 N281K probably benign Het
Myo16 A T 8: 10,370,955 Y265F probably damaging Het
Myoc G A 1: 162,648,441 G238E probably damaging Het
Nlrp12 A C 7: 3,240,407 S492A probably damaging Het
Obscn A G 11: 58,994,746 probably benign Het
Olfr1413 A G 1: 92,573,260 T30A probably benign Het
Olfr486 G T 7: 108,171,927 D272E probably benign Het
Oplah T A 15: 76,297,134 Q1202L probably benign Het
Ppargc1b G A 18: 61,307,694 R718W probably damaging Het
Pwwp2b A T 7: 139,254,928 D95V possibly damaging Het
Rnf225 T C 7: 12,928,158 L88P probably damaging Het
Slc12a1 A G 2: 125,214,009 D820G probably benign Het
Slc12a4 G T 8: 105,947,479 probably benign Het
Slx4 C T 16: 3,988,000 A72T probably benign Het
Snrnp200 T C 2: 127,238,063 I1920T probably damaging Het
Stap2 C T 17: 55,999,976 V234M probably damaging Het
Sv2b A G 7: 75,117,741 F636L probably benign Het
Tdp1 C T 12: 99,935,052 T531I probably benign Het
Thra G A 11: 98,764,352 V353I probably benign Het
Tm7sf2 A G 19: 6,066,422 probably benign Het
Tmx4 A T 2: 134,600,998 probably null Het
Tnfrsf12a A G 17: 23,676,145 probably null Het
Trav6n-5 T A 14: 53,104,911 M14K probably benign Het
Ttn T A 2: 76,742,280 I26090F probably damaging Het
Tut1 G T 19: 8,962,759 R369L probably benign Het
Uba5 T A 9: 104,054,148 T241S probably benign Het
Unc13d T C 11: 116,069,165 T597A probably benign Het
Vmn1r58 A T 7: 5,410,388 I281K probably damaging Het
Vmn1r59 A G 7: 5,454,434 V109A probably benign Het
Xdh T A 17: 73,907,632 M773L probably benign Het
Zfp64 A T 2: 168,925,715 I659N possibly damaging Het
Other mutations in Auts2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01739:Auts2 APN 5 131440218 missense probably benign 0.00
IGL01751:Auts2 APN 5 131472360 missense probably damaging 0.99
IGL02070:Auts2 APN 5 131470421 missense probably damaging 1.00
R0032:Auts2 UTSW 5 131440093 missense probably damaging 1.00
R0046:Auts2 UTSW 5 131770785 exon noncoding transcript
R0399:Auts2 UTSW 5 131440524 missense probably benign 0.37
R0412:Auts2 UTSW 5 131446831 missense probably benign 0.02
R0551:Auts2 UTSW 5 131440469 missense possibly damaging 0.75
R1536:Auts2 UTSW 5 131487463 intron probably benign
R1573:Auts2 UTSW 5 131440487 missense probably damaging 1.00
R1789:Auts2 UTSW 5 131472450 missense probably damaging 1.00
R1912:Auts2 UTSW 5 131443574 missense probably damaging 1.00
R2431:Auts2 UTSW 5 132259048 nonsense probably null
R3745:Auts2 UTSW 5 131476587 utr 5 prime probably benign
R4290:Auts2 UTSW 5 131474971 missense probably damaging 1.00
R4575:Auts2 UTSW 5 132258934 missense probably benign 0.17
R4576:Auts2 UTSW 5 132258934 missense probably benign 0.17
R4578:Auts2 UTSW 5 132258934 missense probably benign 0.17
R4623:Auts2 UTSW 5 131440383 missense probably benign 0.25
R4632:Auts2 UTSW 5 131472275 missense probably damaging 1.00
R4663:Auts2 UTSW 5 131439638 missense probably damaging 1.00
R4835:Auts2 UTSW 5 131466093 missense probably damaging 1.00
R4881:Auts2 UTSW 5 131472450 missense probably damaging 1.00
R5030:Auts2 UTSW 5 131443498 missense probably benign 0.00
R5032:Auts2 UTSW 5 131476891 utr 5 prime probably benign
R5078:Auts2 UTSW 5 132258947 missense possibly damaging 0.85
R5093:Auts2 UTSW 5 131439458 missense probably damaging 0.99
R5182:Auts2 UTSW 5 131475081 missense probably null 0.01
R5305:Auts2 UTSW 5 131443794 intron probably benign
R5429:Auts2 UTSW 5 131472335 missense probably damaging 1.00
R5601:Auts2 UTSW 5 131476823 utr 5 prime probably benign
R5725:Auts2 UTSW 5 131439746 missense probably benign 0.35
R5990:Auts2 UTSW 5 131476895 utr 5 prime probably benign
R6074:Auts2 UTSW 5 131476989 utr 5 prime probably benign
R6130:Auts2 UTSW 5 131440223 missense probably damaging 1.00
R6321:Auts2 UTSW 5 131466115 missense probably damaging 1.00
R6974:Auts2 UTSW 5 131440599 missense probably benign 0.01
R7000:Auts2 UTSW 5 131440218 missense probably benign 0.01
R7014:Auts2 UTSW 5 131466123 missense probably damaging 1.00
R7154:Auts2 UTSW 5 131451893 missense
R7812:Auts2 UTSW 5 131472446 missense
R7922:Auts2 UTSW 5 131440373 missense
R8159:Auts2 UTSW 5 131460125 critical splice donor site probably null
R8553:Auts2 UTSW 5 131440143 missense probably benign 0.00
Z1088:Auts2 UTSW 5 131476554 splice site probably benign
Predicted Primers PCR Primer
(F):5'- TGTAATCATGAGGCTCCCTGTCCC -3'
(R):5'- AGATCACGACCTACCTACTGAGGC -3'

Sequencing Primer
(F):5'- TCGGCTTCATACAACCGGG -3'
(R):5'- TACCTACTGAGGCCCCCC -3'
Posted On2013-08-06