Incidental Mutation 'R8350:Dmp1'
ID645463
Institutional Source Beutler Lab
Gene Symbol Dmp1
Ensembl Gene ENSMUSG00000029307
Gene Namedentin matrix protein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8350 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location104202613-104214102 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104212899 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 480 (K480N)
Ref Sequence ENSEMBL: ENSMUSP00000068053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066708]
Predicted Effect probably damaging
Transcript: ENSMUST00000066708
AA Change: K480N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000068053
Gene: ENSMUSG00000029307
AA Change: K480N

DomainStartEndE-ValueType
Pfam:DMP1 1 503 9.8e-206 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dentin matrix acidic phosphoprotein is an extracellular matrix protein and a member of the small integrin binding ligand N-linked glycoprotein family. This protein, which is critical for proper mineralization of bone and dentin, is present in diverse cells of bone and tooth tissues. The protein contains a large number of acidic domains, multiple phosphorylation sites, a functional arg-gly-asp cell attachment sequence, and a DNA binding domain. In undifferentiated osteoblasts it is primarily a nuclear protein that regulates the expression of osteoblast-specific genes. During osteoblast maturation the protein becomes phosphorylated and is exported to the extracellular matrix, where it orchestrates mineralized matrix formation. Mutations in the gene are known to cause autosomal recessive hypophosphatemia, a disease that manifests as rickets and osteomalacia. The gene structure is conserved in mammals. Two transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypophosphatemia, rickets, osteomalacia, renal phosphate-wasting, impaired osteocyte maturation, defective dentinogenesis, and severe alveolar bone and cementum defects leading to early periodontal breakdown. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik G A 5: 138,562,926 T158M probably benign Het
Akirin2 T A 4: 34,551,082 F13Y probably damaging Het
Arhgef2 G A 3: 88,646,220 R886H probably damaging Het
Armc12 T A 17: 28,532,057 D82E probably damaging Het
Atg2a T C 19: 6,246,811 S382P probably benign Het
Bola1 G A 3: 96,197,257 A7V probably benign Het
Cep170 A G 1: 176,736,879 L271S Het
Cers3 T C 7: 66,764,342 F92S possibly damaging Het
Chmp4c A T 3: 10,385,686 M109L possibly damaging Het
Cnmd T A 14: 79,645,381 K202* probably null Het
Cnp T C 11: 100,576,441 I70T probably damaging Het
Col27a1 C A 4: 63,329,897 T1721K unknown Het
Crtac1 G A 19: 42,309,186 R242W probably damaging Het
Cry2 T C 2: 92,413,941 R296G probably benign Het
Cyp2t4 A G 7: 27,157,381 D282G possibly damaging Het
Dip2a G T 10: 76,264,856 T1495N probably damaging Het
Dmbt1 T C 7: 131,085,417 probably null Het
Dnah17 A G 11: 118,087,047 S1820P probably damaging Het
Dnah6 A G 6: 73,195,815 V220A probably benign Het
Epha3 T C 16: 63,652,490 D344G possibly damaging Het
Esyt2 C A 12: 116,363,482 Q557K probably damaging Het
Fam72a A T 1: 131,533,925 D116V probably damaging Het
Fam81a T C 9: 70,125,018 N64S probably damaging Het
Fat3 T A 9: 15,915,139 T358S Het
Frat2 A T 19: 41,847,784 I43N probably damaging Het
Fryl A T 5: 73,068,730 D1863E probably benign Het
Gm43302 A T 5: 105,274,707 probably null Het
Gm8994 C T 6: 136,329,243 T234I possibly damaging Het
Grid2ip A G 5: 143,377,518 Y422C probably damaging Het
Hap1 T G 11: 100,349,281 D563A probably damaging Het
Hbb-bs T C 7: 103,826,744 D122G probably benign Het
Hs3st3b1 G C 11: 63,889,564 P246A probably benign Het
Hsd17b4 T G 18: 50,164,667 L341R probably benign Het
Kbtbd11 G A 8: 15,028,603 V401M probably damaging Het
Lss T A 10: 76,535,595 L120Q probably damaging Het
Mdc1 T G 17: 35,848,299 S524A probably benign Het
Myoz3 T C 18: 60,579,002 Y168C probably damaging Het
Nceh1 C A 3: 27,239,664 D190E probably damaging Het
Neb T C 2: 52,206,182 R5039G probably benign Het
Nup50 T A 15: 84,935,275 V250E probably benign Het
Pcnx3 T A 19: 5,673,226 N1314Y probably damaging Het
Pdzk1 A G 3: 96,851,708 N143S probably benign Het
Rnf223 T G 4: 156,132,663 L165R probably damaging Het
Sbf1 A T 15: 89,299,509 F1267Y probably damaging Het
Scrn3 T G 2: 73,329,769 I252R possibly damaging Het
Sdr39u1 T C 14: 55,897,906 I193M probably damaging Het
Sh2d7 A G 9: 54,540,907 R71G probably benign Het
Slc12a9 C A 5: 137,315,475 V741L probably benign Het
Syk T C 13: 52,620,899 L225P probably damaging Het
Tbx1 A T 16: 18,582,045 V463E unknown Het
Tmem67 C T 4: 12,087,891 R19H probably benign Het
Ttn T A 2: 76,778,764 I17666F possibly damaging Het
Vcpip1 A G 1: 9,724,606 V1180A probably benign Het
Wdr27 T C 17: 14,932,525 T107A probably benign Het
Zfp106 T C 2: 120,535,618 R58G Het
Other mutations in Dmp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Dmp1 APN 5 104210155 splice site probably benign
IGL01063:Dmp1 APN 5 104207099 start codon destroyed probably null 0.73
IGL01599:Dmp1 APN 5 104212462 nonsense probably null
IGL01631:Dmp1 APN 5 104212868 missense probably benign 0.04
IGL01646:Dmp1 APN 5 104211865 missense probably damaging 1.00
IGL02611:Dmp1 APN 5 104212514 missense probably damaging 1.00
IGL02642:Dmp1 APN 5 104211670 missense probably damaging 0.97
choppers UTSW 5 104207125 missense probably damaging 1.00
R0197:Dmp1 UTSW 5 104207630 missense possibly damaging 0.82
R0494:Dmp1 UTSW 5 104212208 missense probably damaging 1.00
R0529:Dmp1 UTSW 5 104212226 missense probably benign 0.03
R0850:Dmp1 UTSW 5 104212787 missense possibly damaging 0.86
R0883:Dmp1 UTSW 5 104207630 missense possibly damaging 0.82
R1858:Dmp1 UTSW 5 104207630 missense possibly damaging 0.92
R1869:Dmp1 UTSW 5 104212076 missense probably damaging 1.00
R1995:Dmp1 UTSW 5 104209913 missense possibly damaging 0.60
R2004:Dmp1 UTSW 5 104211924 missense possibly damaging 0.73
R2009:Dmp1 UTSW 5 104212840 missense probably damaging 0.97
R2870:Dmp1 UTSW 5 104212108 missense probably benign 0.05
R2870:Dmp1 UTSW 5 104212108 missense probably benign 0.05
R4716:Dmp1 UTSW 5 104212561 missense probably damaging 0.99
R5687:Dmp1 UTSW 5 104207086 start gained probably benign
R6331:Dmp1 UTSW 5 104207125 missense probably damaging 1.00
R6389:Dmp1 UTSW 5 104212922 missense probably damaging 1.00
R7006:Dmp1 UTSW 5 104212322 missense probably benign 0.02
R7103:Dmp1 UTSW 5 104211863 missense probably damaging 1.00
R7699:Dmp1 UTSW 5 104211724 missense probably damaging 1.00
R8181:Dmp1 UTSW 5 104211514 splice site probably null
R8379:Dmp1 UTSW 5 104211705 nonsense probably null
R8450:Dmp1 UTSW 5 104212899 missense probably damaging 0.99
R8531:Dmp1 UTSW 5 104212403 missense probably damaging 1.00
Z1177:Dmp1 UTSW 5 104211652 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGAACACATTCTCCAGCTCAG -3'
(R):5'- TCCAACAGTTCCTCACAGGG -3'

Sequencing Primer
(F):5'- TCTCCGAGGAGAGTCAGGAGTC -3'
(R):5'- CAGTTCCTCACAGGGGGAAAAC -3'
Posted On2020-09-02