Incidental Mutation 'R0033:Gstk1'
ID64547
Institutional Source Beutler Lab
Gene Symbol Gstk1
Ensembl Gene ENSMUSG00000029864
Gene Nameglutathione S-transferase kappa 1
Synonyms0610025I19Rik, DsbA-L
MMRRC Submission 038327-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R0033 (G1)
Quality Score92
Status Validated
Chromosome6
Chromosomal Location42245935-42250447 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 42246803 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031897] [ENSMUST00000204088]
Predicted Effect probably benign
Transcript: ENSMUST00000031897
SMART Domains Protein: ENSMUSP00000031897
Gene: ENSMUSG00000029864

DomainStartEndE-ValueType
Pfam:DSBA 7 211 1.7e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203174
Predicted Effect probably benign
Transcript: ENSMUST00000204088
SMART Domains Protein: ENSMUSP00000145070
Gene: ENSMUSG00000029864

DomainStartEndE-ValueType
Pfam:DSBA 7 143 2.7e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204792
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 93.3%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kappa class of the glutathione transferase superfamily of enzymes that function in cellular detoxification. The encoded protein is localized to the peroxisome and catalyzes the conjugation of glutathione to a wide range of hydrophobic substates facilitating the removal of these compounds from cells. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal male survival curves associated with increased glomerular nephropathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik T C 1: 120,188,064 F110L probably damaging Het
Agr3 C T 12: 35,928,330 T14M possibly damaging Het
Ankib1 A C 5: 3,769,588 D110E possibly damaging Het
Auts2 G C 5: 131,440,093 D571E probably damaging Het
Cacna1d T A 14: 30,105,489 Q993L probably damaging Het
Cdkn3 C A 14: 46,768,872 Y141* probably null Het
Ceacam12 T G 7: 18,069,460 probably benign Het
Celf1 T C 2: 91,001,453 probably benign Het
Col6a3 A G 1: 90,802,245 S1780P probably damaging Het
Csf3r A G 4: 126,031,884 T151A probably benign Het
Ctss G A 3: 95,545,577 probably benign Het
D430042O09Rik T G 7: 125,761,827 V103G possibly damaging Het
Emilin2 G T 17: 71,275,014 T239K probably benign Het
Erp44 T C 4: 48,241,289 probably benign Het
Fbxl4 T C 4: 22,377,017 V151A probably damaging Het
Fer1l4 G A 2: 156,024,106 probably benign Het
Gm12794 A T 4: 101,941,684 Y284F probably benign Het
Gm43302 T C 5: 105,276,844 D310G probably benign Het
Hapln1 A T 13: 89,601,813 Q159L probably benign Het
Hibch A G 1: 52,905,451 K296R probably null Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kdm7a A T 6: 39,165,197 Y382* probably null Het
Kirrel3 A G 9: 35,000,963 I208V probably benign Het
Klc4 A T 17: 46,635,433 C489S probably damaging Het
Lrrc8a G T 2: 30,255,345 C57F probably damaging Het
Ltbp1 A G 17: 75,276,509 N435D possibly damaging Het
Macc1 T A 12: 119,446,341 N281K probably benign Het
Myo16 A T 8: 10,370,955 Y265F probably damaging Het
Myoc G A 1: 162,648,441 G238E probably damaging Het
Nlrp12 A C 7: 3,240,407 S492A probably damaging Het
Obscn A G 11: 58,994,746 probably benign Het
Olfr1413 A G 1: 92,573,260 T30A probably benign Het
Olfr486 G T 7: 108,171,927 D272E probably benign Het
Oplah T A 15: 76,297,134 Q1202L probably benign Het
Ppargc1b G A 18: 61,307,694 R718W probably damaging Het
Pwwp2b A T 7: 139,254,928 D95V possibly damaging Het
Rnf225 T C 7: 12,928,158 L88P probably damaging Het
Slc12a1 A G 2: 125,214,009 D820G probably benign Het
Slc12a4 G T 8: 105,947,479 probably benign Het
Slx4 C T 16: 3,988,000 A72T probably benign Het
Snrnp200 T C 2: 127,238,063 I1920T probably damaging Het
Stap2 C T 17: 55,999,976 V234M probably damaging Het
Sv2b A G 7: 75,117,741 F636L probably benign Het
Tdp1 C T 12: 99,935,052 T531I probably benign Het
Thra G A 11: 98,764,352 V353I probably benign Het
Tm7sf2 A G 19: 6,066,422 probably benign Het
Tmx4 A T 2: 134,600,998 probably null Het
Tnfrsf12a A G 17: 23,676,145 probably null Het
Trav6n-5 T A 14: 53,104,911 M14K probably benign Het
Ttn T A 2: 76,742,280 I26090F probably damaging Het
Tut1 G T 19: 8,962,759 R369L probably benign Het
Uba5 T A 9: 104,054,148 T241S probably benign Het
Unc13d T C 11: 116,069,165 T597A probably benign Het
Vmn1r58 A T 7: 5,410,388 I281K probably damaging Het
Vmn1r59 A G 7: 5,454,434 V109A probably benign Het
Xdh T A 17: 73,907,632 M773L probably benign Het
Zfp64 A T 2: 168,925,715 I659N possibly damaging Het
Other mutations in Gstk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Gstk1 APN 6 42246626 missense possibly damaging 0.80
IGL02864:Gstk1 APN 6 42247753 missense possibly damaging 0.48
IGL03119:Gstk1 APN 6 42249899 missense probably damaging 1.00
IGL03165:Gstk1 APN 6 42249434 missense probably benign 0.02
R1460:Gstk1 UTSW 6 42246595 missense probably damaging 1.00
R1699:Gstk1 UTSW 6 42246601 missense probably benign 0.00
R2329:Gstk1 UTSW 6 42246914 missense possibly damaging 0.67
R4831:Gstk1 UTSW 6 42246004 start gained probably benign
R6187:Gstk1 UTSW 6 42249860 missense possibly damaging 0.63
R7096:Gstk1 UTSW 6 42249473 missense probably damaging 1.00
R7822:Gstk1 UTSW 6 42247752 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GGTAAGCATGAAGAAGCTCCACCTC -3'
(R):5'- AGGACCGTGTCATCCTTCCTTCAG -3'

Sequencing Primer
(F):5'- GAAGAAGCTCCACCTCTCTGG -3'
(R):5'- cctctgaaactggagttataggtg -3'
Posted On2013-08-06