Incidental Mutation 'R8350:Hbb-bs'
ID 645472
Institutional Source Beutler Lab
Gene Symbol Hbb-bs
Ensembl Gene ENSMUSG00000052305
Gene Name hemoglobin, beta adult s chain
Synonyms beta s
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.202) question?
Stock # R8350 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 103826534-103828096 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 103826744 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 122 (D122G)
Ref Sequence ENSEMBL: ENSMUSP00000023934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023934] [ENSMUST00000153218]
AlphaFold A8DUK4
Predicted Effect probably benign
Transcript: ENSMUST00000023934
AA Change: D122G

PolyPhen 2 Score 0.420 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000023934
Gene: ENSMUSG00000052305
AA Change: D122G

DomainStartEndE-ValueType
Pfam:Globin 8 112 1.3e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131960
Predicted Effect probably benign
Transcript: ENSMUST00000153218
SMART Domains Protein: ENSMUSP00000115607
Gene: ENSMUSG00000052305

DomainStartEndE-ValueType
Pfam:Globin 8 103 3.8e-29 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a beta polypeptide chain found in adult hemoglobin, which consists of a tetramer of two alpha chains and two beta chains, and which functions in the transport of oxygen to various peripheral tissues. This gene is one of a cluster of beta-hemoglobin genes that are distally regulated by a locus control region, and which are organized along the chromosome in the order of their developmental expression. In mouse, two major strain-specific haplotypes of the beta-globin gene cluster are found - a "single" haplotype found in C57BL/-type strains, which includes two highly similar adult beta-globin genes, beta s and beta t, and a "diffuse" haplotype found in strains such as BALB/c and 129Sv, which includes two somewhat diverse adult beta-globin genes, beta-major and beta-minor. This gene represents the beta s adult gene found in the "single" haplotype. Primary chromosome 7 of the mouse reference genome assembly, which is derived from C57BL/6 strain mice, represents the "single" haplotype, while the "diffuse" haplotype is represented in the reference genome collection by the BALB/c strain alternate contig, NT_095534.1. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik G A 5: 138,562,926 T158M probably benign Het
Akirin2 T A 4: 34,551,082 F13Y probably damaging Het
Arhgef2 G A 3: 88,646,220 R886H probably damaging Het
Armc12 T A 17: 28,532,057 D82E probably damaging Het
Atg2a T C 19: 6,246,811 S382P probably benign Het
Bola1 G A 3: 96,197,257 A7V probably benign Het
Cep170 A G 1: 176,736,879 L271S Het
Cers3 T C 7: 66,764,342 F92S possibly damaging Het
Chmp4c A T 3: 10,385,686 M109L possibly damaging Het
Cnmd T A 14: 79,645,381 K202* probably null Het
Cnp T C 11: 100,576,441 I70T probably damaging Het
Col27a1 C A 4: 63,329,897 T1721K unknown Het
Crtac1 G A 19: 42,309,186 R242W probably damaging Het
Cry2 T C 2: 92,413,941 R296G probably benign Het
Cyp2t4 A G 7: 27,157,381 D282G possibly damaging Het
Dip2a G T 10: 76,264,856 T1495N probably damaging Het
Dmbt1 T C 7: 131,085,417 probably null Het
Dmp1 A T 5: 104,212,899 K480N probably damaging Het
Dnah17 A G 11: 118,087,047 S1820P probably damaging Het
Dnah6 A G 6: 73,195,815 V220A probably benign Het
Epha3 T C 16: 63,652,490 D344G possibly damaging Het
Esyt2 C A 12: 116,363,482 Q557K probably damaging Het
Fam72a A T 1: 131,533,925 D116V probably damaging Het
Fam81a T C 9: 70,125,018 N64S probably damaging Het
Fat3 T A 9: 15,915,139 T358S Het
Frat2 A T 19: 41,847,784 I43N probably damaging Het
Fryl A T 5: 73,068,730 D1863E probably benign Het
Gm43302 A T 5: 105,274,707 probably null Het
Gm8994 C T 6: 136,329,243 T234I possibly damaging Het
Grid2ip A G 5: 143,377,518 Y422C probably damaging Het
Hap1 T G 11: 100,349,281 D563A probably damaging Het
Hs3st3b1 G C 11: 63,889,564 P246A probably benign Het
Hsd17b4 T G 18: 50,164,667 L341R probably benign Het
Kbtbd11 G A 8: 15,028,603 V401M probably damaging Het
Lss T A 10: 76,535,595 L120Q probably damaging Het
Mdc1 T G 17: 35,848,299 S524A probably benign Het
Myoz3 T C 18: 60,579,002 Y168C probably damaging Het
Nceh1 C A 3: 27,239,664 D190E probably damaging Het
Neb T C 2: 52,206,182 R5039G probably benign Het
Nup50 T A 15: 84,935,275 V250E probably benign Het
Pcnx3 T A 19: 5,673,226 N1314Y probably damaging Het
Pdzk1 A G 3: 96,851,708 N143S probably benign Het
Rnf223 T G 4: 156,132,663 L165R probably damaging Het
Sbf1 A T 15: 89,299,509 F1267Y probably damaging Het
Scrn3 T G 2: 73,329,769 I252R possibly damaging Het
Sdr39u1 T C 14: 55,897,906 I193M probably damaging Het
Sh2d7 A G 9: 54,540,907 R71G probably benign Het
Slc12a9 C A 5: 137,315,475 V741L probably benign Het
Syk T C 13: 52,620,899 L225P probably damaging Het
Tbx1 A T 16: 18,582,045 V463E unknown Het
Tmem67 C T 4: 12,087,891 R19H probably benign Het
Ttn T A 2: 76,778,764 I17666F possibly damaging Het
Vcpip1 A G 1: 9,724,606 V1180A probably benign Het
Wdr27 T C 17: 14,932,525 T107A probably benign Het
Zfp106 T C 2: 120,535,618 R58G Het
Other mutations in Hbb-bs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02507:Hbb-bs APN 7 103827884 splice site probably benign
IGL03120:Hbb-bs APN 7 103827778 splice site probably benign
R0219:Hbb-bs UTSW 7 103826669 missense possibly damaging 0.78
R2243:Hbb-bs UTSW 7 103827811 missense possibly damaging 0.51
R4297:Hbb-bs UTSW 7 103826744 missense probably benign 0.42
R4921:Hbb-bs UTSW 7 103826720 missense probably damaging 0.98
R5802:Hbb-bs UTSW 7 103826672 missense probably damaging 1.00
R6908:Hbb-bs UTSW 7 103827534 missense probably benign 0.00
R8450:Hbb-bs UTSW 7 103826744 missense probably benign 0.42
R8509:Hbb-bs UTSW 7 103826712 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTAGCATAAACCCTTCTATGACACAG -3'
(R):5'- TTTATGCCAGGGTGACAGGG -3'

Sequencing Primer
(F):5'- ACATCATTGCAGTGAAATAAATGC -3'
(R):5'- GGTGACAGGGGAAGAATATATTTTAC -3'
Posted On 2020-09-02