Incidental Mutation 'R8350:Dip2a'
ID645478
Institutional Source Beutler Lab
Gene Symbol Dip2a
Ensembl Gene ENSMUSG00000020231
Gene Namedisco interacting protein 2 homolog A
SynonymsKiaa0184-hp, 4931420H10Rik, Dip2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8350 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location76259429-76345291 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 76264856 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 1495 (T1495N)
Ref Sequence ENSEMBL: ENSMUSP00000101057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036033] [ENSMUST00000036387] [ENSMUST00000105417] [ENSMUST00000160048] [ENSMUST00000162524]
Predicted Effect probably damaging
Transcript: ENSMUST00000036033
AA Change: T1485N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043710
Gene: ENSMUSG00000020231
AA Change: T1485N

DomainStartEndE-ValueType
DMAP_binding 9 122 2.55e-35 SMART
low complexity region 173 208 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
Pfam:AMP-binding 330 806 4.3e-26 PFAM
Pfam:AMP-binding 982 1456 1.4e-52 PFAM
low complexity region 1487 1498 N/A INTRINSIC
low complexity region 1511 1532 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036387
SMART Domains Protein: ENSMUSP00000047968
Gene: ENSMUSG00000033208

DomainStartEndE-ValueType
Pfam:S_100 4 47 5.5e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105417
AA Change: T1495N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101057
Gene: ENSMUSG00000020231
AA Change: T1495N

DomainStartEndE-ValueType
DMAP_binding 9 122 2.55e-35 SMART
low complexity region 173 208 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
Pfam:AMP-binding 330 806 6.6e-28 PFAM
Pfam:AMP-binding 992 1466 7.3e-65 PFAM
low complexity region 1497 1508 N/A INTRINSIC
low complexity region 1521 1542 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160048
AA Change: T1446N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125184
Gene: ENSMUSG00000020231
AA Change: T1446N

DomainStartEndE-ValueType
DMAP_binding 9 83 7.94e-23 SMART
low complexity region 134 169 N/A INTRINSIC
low complexity region 242 254 N/A INTRINSIC
Pfam:AMP-binding 291 767 5.3e-26 PFAM
Pfam:AMP-binding 943 1417 1.7e-52 PFAM
low complexity region 1448 1459 N/A INTRINSIC
low complexity region 1472 1493 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162524
AA Change: T10N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125614
Gene: ENSMUSG00000020231
AA Change: T10N

DomainStartEndE-ValueType
SCOP:d1lci__ 1 77 9e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may be involved in axon patterning in the central nervous system. This gene is not highly expressed. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik G A 5: 138,562,926 T158M probably benign Het
Akirin2 T A 4: 34,551,082 F13Y probably damaging Het
Arhgef2 G A 3: 88,646,220 R886H probably damaging Het
Armc12 T A 17: 28,532,057 D82E probably damaging Het
Atg2a T C 19: 6,246,811 S382P probably benign Het
Bola1 G A 3: 96,197,257 A7V probably benign Het
Cep170 A G 1: 176,736,879 L271S Het
Cers3 T C 7: 66,764,342 F92S possibly damaging Het
Chmp4c A T 3: 10,385,686 M109L possibly damaging Het
Cnmd T A 14: 79,645,381 K202* probably null Het
Cnp T C 11: 100,576,441 I70T probably damaging Het
Col27a1 C A 4: 63,329,897 T1721K unknown Het
Crtac1 G A 19: 42,309,186 R242W probably damaging Het
Cry2 T C 2: 92,413,941 R296G probably benign Het
Cyp2t4 A G 7: 27,157,381 D282G possibly damaging Het
Dmbt1 T C 7: 131,085,417 probably null Het
Dmp1 A T 5: 104,212,899 K480N probably damaging Het
Dnah17 A G 11: 118,087,047 S1820P probably damaging Het
Dnah6 A G 6: 73,195,815 V220A probably benign Het
Epha3 T C 16: 63,652,490 D344G possibly damaging Het
Esyt2 C A 12: 116,363,482 Q557K probably damaging Het
Fam72a A T 1: 131,533,925 D116V probably damaging Het
Fam81a T C 9: 70,125,018 N64S probably damaging Het
Fat3 T A 9: 15,915,139 T358S Het
Frat2 A T 19: 41,847,784 I43N probably damaging Het
Fryl A T 5: 73,068,730 D1863E probably benign Het
Gm43302 A T 5: 105,274,707 probably null Het
Gm8994 C T 6: 136,329,243 T234I possibly damaging Het
Grid2ip A G 5: 143,377,518 Y422C probably damaging Het
Hap1 T G 11: 100,349,281 D563A probably damaging Het
Hbb-bs T C 7: 103,826,744 D122G probably benign Het
Hs3st3b1 G C 11: 63,889,564 P246A probably benign Het
Hsd17b4 T G 18: 50,164,667 L341R probably benign Het
Kbtbd11 G A 8: 15,028,603 V401M probably damaging Het
Lss T A 10: 76,535,595 L120Q probably damaging Het
Mdc1 T G 17: 35,848,299 S524A probably benign Het
Myoz3 T C 18: 60,579,002 Y168C probably damaging Het
Nceh1 C A 3: 27,239,664 D190E probably damaging Het
Neb T C 2: 52,206,182 R5039G probably benign Het
Nup50 T A 15: 84,935,275 V250E probably benign Het
Pcnx3 T A 19: 5,673,226 N1314Y probably damaging Het
Pdzk1 A G 3: 96,851,708 N143S probably benign Het
Rnf223 T G 4: 156,132,663 L165R probably damaging Het
Sbf1 A T 15: 89,299,509 F1267Y probably damaging Het
Scrn3 T G 2: 73,329,769 I252R possibly damaging Het
Sdr39u1 T C 14: 55,897,906 I193M probably damaging Het
Sh2d7 A G 9: 54,540,907 R71G probably benign Het
Slc12a9 C A 5: 137,315,475 V741L probably benign Het
Syk T C 13: 52,620,899 L225P probably damaging Het
Tbx1 A T 16: 18,582,045 V463E unknown Het
Tmem67 C T 4: 12,087,891 R19H probably benign Het
Ttn T A 2: 76,778,764 I17666F possibly damaging Het
Vcpip1 A G 1: 9,724,606 V1180A probably benign Het
Wdr27 T C 17: 14,932,525 T107A probably benign Het
Zfp106 T C 2: 120,535,618 R58G Het
Other mutations in Dip2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Dip2a APN 10 76313236 missense probably benign
IGL00849:Dip2a APN 10 76292318 missense probably damaging 0.99
IGL01685:Dip2a APN 10 76327749 missense probably damaging 1.00
IGL01825:Dip2a APN 10 76272680 nonsense probably null
IGL02343:Dip2a APN 10 76319478 missense probably benign 0.00
IGL02437:Dip2a APN 10 76298267 missense probably benign 0.09
IGL02981:Dip2a APN 10 76276421 missense possibly damaging 0.84
IGL03122:Dip2a APN 10 76275046 missense probably benign 0.00
IGL03261:Dip2a APN 10 76305148 missense possibly damaging 0.80
R0369:Dip2a UTSW 10 76298787 missense probably damaging 1.00
R0522:Dip2a UTSW 10 76321531 missense probably benign 0.03
R0962:Dip2a UTSW 10 76292432 unclassified probably benign
R1164:Dip2a UTSW 10 76276397 missense possibly damaging 0.72
R1309:Dip2a UTSW 10 76279776 missense probably damaging 1.00
R1426:Dip2a UTSW 10 76279820 unclassified probably benign
R1636:Dip2a UTSW 10 76321578 missense probably benign 0.01
R1823:Dip2a UTSW 10 76278502 nonsense probably null
R1830:Dip2a UTSW 10 76317963 missense probably damaging 1.00
R1876:Dip2a UTSW 10 76318091 missense probably damaging 1.00
R2284:Dip2a UTSW 10 76313193 missense probably benign 0.01
R2369:Dip2a UTSW 10 76313196 missense probably benign
R4050:Dip2a UTSW 10 76278607 missense probably damaging 1.00
R4089:Dip2a UTSW 10 76278489 splice site probably null
R4231:Dip2a UTSW 10 76319470 missense probably damaging 1.00
R4715:Dip2a UTSW 10 76296406 missense probably benign 0.34
R4752:Dip2a UTSW 10 76276657 missense probably damaging 1.00
R4846:Dip2a UTSW 10 76321493 missense probably damaging 1.00
R4849:Dip2a UTSW 10 76294533 missense probably damaging 1.00
R4892:Dip2a UTSW 10 76280759 missense probably benign 0.02
R4998:Dip2a UTSW 10 76319556 nonsense probably null
R5068:Dip2a UTSW 10 76318043 missense possibly damaging 0.82
R5141:Dip2a UTSW 10 76270453 missense probably damaging 1.00
R5253:Dip2a UTSW 10 76299997 missense probably damaging 1.00
R5304:Dip2a UTSW 10 76294523 missense possibly damaging 0.67
R5324:Dip2a UTSW 10 76296393 missense probably damaging 1.00
R5369:Dip2a UTSW 10 76292360 missense probably damaging 1.00
R6272:Dip2a UTSW 10 76286407 makesense probably null
R6884:Dip2a UTSW 10 76272532 critical splice donor site probably null
R7143:Dip2a UTSW 10 76297791 missense probably damaging 1.00
R7247:Dip2a UTSW 10 76272532 critical splice donor site probably null
R7252:Dip2a UTSW 10 76273202 missense not run
R7327:Dip2a UTSW 10 76272562 missense probably benign 0.41
R7334:Dip2a UTSW 10 76274246 missense possibly damaging 0.91
R7349:Dip2a UTSW 10 76285592 missense probably damaging 1.00
R7360:Dip2a UTSW 10 76278560 missense probably damaging 1.00
R7513:Dip2a UTSW 10 76313235 missense probably benign
R7793:Dip2a UTSW 10 76278583 missense probably benign 0.06
R7794:Dip2a UTSW 10 76276625 missense probably damaging 1.00
R7819:Dip2a UTSW 10 76291028 missense probably benign 0.06
R8079:Dip2a UTSW 10 76287321 missense probably benign
R8280:Dip2a UTSW 10 76264776 missense possibly damaging 0.75
R8281:Dip2a UTSW 10 76276604 missense probably damaging 1.00
R8286:Dip2a UTSW 10 76286463 missense probably benign
R8450:Dip2a UTSW 10 76264856 missense probably damaging 1.00
Z1088:Dip2a UTSW 10 76285628 missense probably benign 0.06
Z1176:Dip2a UTSW 10 76266323 missense possibly damaging 0.94
Z1176:Dip2a UTSW 10 76280820 missense probably damaging 0.97
Z1177:Dip2a UTSW 10 76266322 missense possibly damaging 0.51
Z1177:Dip2a UTSW 10 76296400 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTAGGCCACGTAGATGGG -3'
(R):5'- AGATAGAGTTAGCTGGGCTTTGAAG -3'

Sequencing Primer
(F):5'- ATCTCGCAGGTGCATGC -3'
(R):5'- GCTTTGAAGTTATGGTGCTAAGTAG -3'
Posted On2020-09-02