Mutagenetix > Incidental Mutations

Incidental Mutation 'R8350:Dip2a'

645478

Institutional Source

Beutler Lab

Gene Symbol

Dip2a

Ensembl Gene

ENSMUSG00000020231

Gene Name

disco interacting protein 2 homolog A

Synonyms

Kiaa0184-hp, 4931420H10Rik, Dip2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8350 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

76259429-76345291 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 76264856 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Asparagine at position 1495 (T1495N)

Ref Sequence

ENSEMBL: ENSMUSP00000101057 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036033] [ENSMUST00000036387] [ENSMUST00000105417] [ENSMUST00000160048] [ENSMUST00000162524]

Predicted Effect

probably damaging
Transcript: ENSMUST00000036033
AA Change: T1485N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000043710
Gene: ENSMUSG00000020231
AA Change: T1485N

Domain	Start	End	E-Value	Type
DMAP_binding	9	122	2.55e-35	SMART
low complexity region	173	208	N/A	INTRINSIC
low complexity region	281	293	N/A	INTRINSIC
Pfam:AMP-binding	330	806	4.3e-26	PFAM
Pfam:AMP-binding	982	1456	1.4e-52	PFAM
low complexity region	1487	1498	N/A	INTRINSIC
low complexity region	1511	1532	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000036387

SMART Domains

Protein: ENSMUSP00000047968
Gene: ENSMUSG00000033208

Domain	Start	End	E-Value	Type
Pfam:S_100	4	47	5.5e-24	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000105417
AA Change: T1495N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101057
Gene: ENSMUSG00000020231
AA Change: T1495N

Domain	Start	End	E-Value	Type
DMAP_binding	9	122	2.55e-35	SMART
low complexity region	173	208	N/A	INTRINSIC
low complexity region	281	293	N/A	INTRINSIC
Pfam:AMP-binding	330	806	6.6e-28	PFAM
Pfam:AMP-binding	992	1466	7.3e-65	PFAM
low complexity region	1497	1508	N/A	INTRINSIC
low complexity region	1521	1542	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000160048
AA Change: T1446N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125184
Gene: ENSMUSG00000020231
AA Change: T1446N

Domain	Start	End	E-Value	Type
DMAP_binding	9	83	7.94e-23	SMART
low complexity region	134	169	N/A	INTRINSIC
low complexity region	242	254	N/A	INTRINSIC
Pfam:AMP-binding	291	767	5.3e-26	PFAM
Pfam:AMP-binding	943	1417	1.7e-52	PFAM
low complexity region	1448	1459	N/A	INTRINSIC
low complexity region	1472	1493	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000162524
AA Change: T10N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125614
Gene: ENSMUSG00000020231
AA Change: T10N

Domain	Start	End	E-Value	Type
SCOP:d1lci__	1	77	9e-5	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may be involved in axon patterning in the central nervous system. This gene is not highly expressed. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123K08Rik	G	A	5: 138,562,926	T158M	probably benign	Het
Akirin2	T	A	4: 34,551,082	F13Y	probably damaging	Het
Arhgef2	G	A	3: 88,646,220	R886H	probably damaging	Het
Armc12	T	A	17: 28,532,057	D82E	probably damaging	Het
Atg2a	T	C	19: 6,246,811	S382P	probably benign	Het
Bola1	G	A	3: 96,197,257	A7V	probably benign	Het
Cep170	A	G	1: 176,736,879	L271S		Het
Cers3	T	C	7: 66,764,342	F92S	possibly damaging	Het
Chmp4c	A	T	3: 10,385,686	M109L	possibly damaging	Het
Cnmd	T	A	14: 79,645,381	K202*	probably null	Het
Cnp	T	C	11: 100,576,441	I70T	probably damaging	Het
Col27a1	C	A	4: 63,329,897	T1721K	unknown	Het
Crtac1	G	A	19: 42,309,186	R242W	probably damaging	Het
Cry2	T	C	2: 92,413,941	R296G	probably benign	Het
Cyp2t4	A	G	7: 27,157,381	D282G	possibly damaging	Het
Dmbt1	T	C	7: 131,085,417		probably null	Het
Dmp1	A	T	5: 104,212,899	K480N	probably damaging	Het
Dnah17	A	G	11: 118,087,047	S1820P	probably damaging	Het
Dnah6	A	G	6: 73,195,815	V220A	probably benign	Het
Epha3	T	C	16: 63,652,490	D344G	possibly damaging	Het
Esyt2	C	A	12: 116,363,482	Q557K	probably damaging	Het
Fam72a	A	T	1: 131,533,925	D116V	probably damaging	Het
Fam81a	T	C	9: 70,125,018	N64S	probably damaging	Het
Fat3	T	A	9: 15,915,139	T358S		Het
Frat2	A	T	19: 41,847,784	I43N	probably damaging	Het
Fryl	A	T	5: 73,068,730	D1863E	probably benign	Het
Gm43302	A	T	5: 105,274,707		probably null	Het
Gm8994	C	T	6: 136,329,243	T234I	possibly damaging	Het
Grid2ip	A	G	5: 143,377,518	Y422C	probably damaging	Het
Hap1	T	G	11: 100,349,281	D563A	probably damaging	Het
Hbb-bs	T	C	7: 103,826,744	D122G	probably benign	Het
Hs3st3b1	G	C	11: 63,889,564	P246A	probably benign	Het
Hsd17b4	T	G	18: 50,164,667	L341R	probably benign	Het
Kbtbd11	G	A	8: 15,028,603	V401M	probably damaging	Het
Lss	T	A	10: 76,535,595	L120Q	probably damaging	Het
Mdc1	T	G	17: 35,848,299	S524A	probably benign	Het
Myoz3	T	C	18: 60,579,002	Y168C	probably damaging	Het
Nceh1	C	A	3: 27,239,664	D190E	probably damaging	Het
Neb	T	C	2: 52,206,182	R5039G	probably benign	Het
Nup50	T	A	15: 84,935,275	V250E	probably benign	Het
Pcnx3	T	A	19: 5,673,226	N1314Y	probably damaging	Het
Pdzk1	A	G	3: 96,851,708	N143S	probably benign	Het
Rnf223	T	G	4: 156,132,663	L165R	probably damaging	Het
Sbf1	A	T	15: 89,299,509	F1267Y	probably damaging	Het
Scrn3	T	G	2: 73,329,769	I252R	possibly damaging	Het
Sdr39u1	T	C	14: 55,897,906	I193M	probably damaging	Het
Sh2d7	A	G	9: 54,540,907	R71G	probably benign	Het
Slc12a9	C	A	5: 137,315,475	V741L	probably benign	Het
Syk	T	C	13: 52,620,899	L225P	probably damaging	Het
Tbx1	A	T	16: 18,582,045	V463E	unknown	Het
Tmem67	C	T	4: 12,087,891	R19H	probably benign	Het
Ttn	T	A	2: 76,778,764	I17666F	possibly damaging	Het
Vcpip1	A	G	1: 9,724,606	V1180A	probably benign	Het
Wdr27	T	C	17: 14,932,525	T107A	probably benign	Het
Zfp106	T	C	2: 120,535,618	R58G		Het

Other mutations in Dip2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00422:Dip2a	APN	10	76313236	missense	probably benign
IGL00849:Dip2a	APN	10	76292318	missense	probably damaging	0.99
IGL01685:Dip2a	APN	10	76327749	missense	probably damaging	1.00
IGL01825:Dip2a	APN	10	76272680	nonsense	probably null
IGL02343:Dip2a	APN	10	76319478	missense	probably benign	0.00
IGL02437:Dip2a	APN	10	76298267	missense	probably benign	0.09
IGL02981:Dip2a	APN	10	76276421	missense	possibly damaging	0.84
IGL03122:Dip2a	APN	10	76275046	missense	probably benign	0.00
IGL03261:Dip2a	APN	10	76305148	missense	possibly damaging	0.80
R0369:Dip2a	UTSW	10	76298787	missense	probably damaging	1.00
R0522:Dip2a	UTSW	10	76321531	missense	probably benign	0.03
R0962:Dip2a	UTSW	10	76292432	unclassified	probably benign
R1164:Dip2a	UTSW	10	76276397	missense	possibly damaging	0.72
R1309:Dip2a	UTSW	10	76279776	missense	probably damaging	1.00
R1426:Dip2a	UTSW	10	76279820	unclassified	probably benign
R1636:Dip2a	UTSW	10	76321578	missense	probably benign	0.01
R1823:Dip2a	UTSW	10	76278502	nonsense	probably null
R1830:Dip2a	UTSW	10	76317963	missense	probably damaging	1.00
R1876:Dip2a	UTSW	10	76318091	missense	probably damaging	1.00
R2284:Dip2a	UTSW	10	76313193	missense	probably benign	0.01
R2369:Dip2a	UTSW	10	76313196	missense	probably benign
R4050:Dip2a	UTSW	10	76278607	missense	probably damaging	1.00
R4089:Dip2a	UTSW	10	76278489	splice site	probably null
R4231:Dip2a	UTSW	10	76319470	missense	probably damaging	1.00
R4715:Dip2a	UTSW	10	76296406	missense	probably benign	0.34
R4752:Dip2a	UTSW	10	76276657	missense	probably damaging	1.00
R4846:Dip2a	UTSW	10	76321493	missense	probably damaging	1.00
R4849:Dip2a	UTSW	10	76294533	missense	probably damaging	1.00
R4892:Dip2a	UTSW	10	76280759	missense	probably benign	0.02
R4998:Dip2a	UTSW	10	76319556	nonsense	probably null
R5068:Dip2a	UTSW	10	76318043	missense	possibly damaging	0.82
R5141:Dip2a	UTSW	10	76270453	missense	probably damaging	1.00
R5253:Dip2a	UTSW	10	76299997	missense	probably damaging	1.00
R5304:Dip2a	UTSW	10	76294523	missense	possibly damaging	0.67
R5324:Dip2a	UTSW	10	76296393	missense	probably damaging	1.00
R5369:Dip2a	UTSW	10	76292360	missense	probably damaging	1.00
R6272:Dip2a	UTSW	10	76286407	makesense	probably null
R6884:Dip2a	UTSW	10	76272532	critical splice donor site	probably null
R7143:Dip2a	UTSW	10	76297791	missense	probably damaging	1.00
R7247:Dip2a	UTSW	10	76272532	critical splice donor site	probably null
R7252:Dip2a	UTSW	10	76273202	missense	not run
R7327:Dip2a	UTSW	10	76272562	missense	probably benign	0.41
R7334:Dip2a	UTSW	10	76274246	missense	possibly damaging	0.91
R7349:Dip2a	UTSW	10	76285592	missense	probably damaging	1.00
R7360:Dip2a	UTSW	10	76278560	missense	probably damaging	1.00
R7513:Dip2a	UTSW	10	76313235	missense	probably benign
R7793:Dip2a	UTSW	10	76278583	missense	probably benign	0.06
R7794:Dip2a	UTSW	10	76276625	missense	probably damaging	1.00
R7819:Dip2a	UTSW	10	76291028	missense	probably benign	0.06
R8079:Dip2a	UTSW	10	76287321	missense	probably benign
R8280:Dip2a	UTSW	10	76264776	missense	possibly damaging	0.75
R8281:Dip2a	UTSW	10	76276604	missense	probably damaging	1.00
R8286:Dip2a	UTSW	10	76286463	missense	probably benign
R8450:Dip2a	UTSW	10	76264856	missense	probably damaging	1.00
Z1088:Dip2a	UTSW	10	76285628	missense	probably benign	0.06
Z1176:Dip2a	UTSW	10	76266323	missense	possibly damaging	0.94
Z1176:Dip2a	UTSW	10	76280820	missense	probably damaging	0.97
Z1177:Dip2a	UTSW	10	76266322	missense	possibly damaging	0.51
Z1177:Dip2a	UTSW	10	76296400	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGTAGGCCACGTAGATGGG -3'
(R):5'- AGATAGAGTTAGCTGGGCTTTGAAG -3'

Sequencing Primer
(F):5'- ATCTCGCAGGTGCATGC -3'
(R):5'- GCTTTGAAGTTATGGTGCTAAGTAG -3'

Posted On

2020-09-02