Incidental Mutation 'R0033:Olfr486'
ID 64551
Institutional Source Beutler Lab
Gene Symbol Olfr486
Ensembl Gene ENSMUSG00000096068
Gene Name olfactory receptor 486
Synonyms MOR204-19, GA_x6K02T2PBJ9-10501920-10500976
MMRRC Submission 038327-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock # R0033 (G1)
Quality Score 83
Status Validated
Chromosome 7
Chromosomal Location 108171798-108172742 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 108171927 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 272 (D272E)
Ref Sequence ENSEMBL: ENSMUSP00000071918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072035]
AlphaFold Q8VFD0
Predicted Effect probably benign
Transcript: ENSMUST00000072035
AA Change: D272E

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000071918
Gene: ENSMUSG00000096068
AA Change: D272E

DomainStartEndE-ValueType
Pfam:7tm_4 31 311 6.8e-51 PFAM
Pfam:7tm_1 44 293 6.6e-24 PFAM
Meta Mutation Damage Score 0.1831 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 93.3%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik T C 1: 120,188,064 F110L probably damaging Het
Agr3 C T 12: 35,928,330 T14M possibly damaging Het
Ankib1 A C 5: 3,769,588 D110E possibly damaging Het
Auts2 G C 5: 131,440,093 D571E probably damaging Het
Cacna1d T A 14: 30,105,489 Q993L probably damaging Het
Cdkn3 C A 14: 46,768,872 Y141* probably null Het
Ceacam12 T G 7: 18,069,460 probably benign Het
Celf1 T C 2: 91,001,453 probably benign Het
Col6a3 A G 1: 90,802,245 S1780P probably damaging Het
Csf3r A G 4: 126,031,884 T151A probably benign Het
Ctss G A 3: 95,545,577 probably benign Het
D430042O09Rik T G 7: 125,761,827 V103G possibly damaging Het
Emilin2 G T 17: 71,275,014 T239K probably benign Het
Erp44 T C 4: 48,241,289 probably benign Het
Fbxl4 T C 4: 22,377,017 V151A probably damaging Het
Fer1l4 G A 2: 156,024,106 probably benign Het
Gm12794 A T 4: 101,941,684 Y284F probably benign Het
Gm43302 T C 5: 105,276,844 D310G probably benign Het
Gstk1 A G 6: 42,246,803 probably benign Het
Hapln1 A T 13: 89,601,813 Q159L probably benign Het
Hibch A G 1: 52,905,451 K296R probably null Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kdm7a A T 6: 39,165,197 Y382* probably null Het
Kirrel3 A G 9: 35,000,963 I208V probably benign Het
Klc4 A T 17: 46,635,433 C489S probably damaging Het
Lrrc8a G T 2: 30,255,345 C57F probably damaging Het
Ltbp1 A G 17: 75,276,509 N435D possibly damaging Het
Macc1 T A 12: 119,446,341 N281K probably benign Het
Myo16 A T 8: 10,370,955 Y265F probably damaging Het
Myoc G A 1: 162,648,441 G238E probably damaging Het
Nlrp12 A C 7: 3,240,407 S492A probably damaging Het
Obscn A G 11: 58,994,746 probably benign Het
Olfr1413 A G 1: 92,573,260 T30A probably benign Het
Oplah T A 15: 76,297,134 Q1202L probably benign Het
Ppargc1b G A 18: 61,307,694 R718W probably damaging Het
Pwwp2b A T 7: 139,254,928 D95V possibly damaging Het
Rnf225 T C 7: 12,928,158 L88P probably damaging Het
Slc12a1 A G 2: 125,214,009 D820G probably benign Het
Slc12a4 G T 8: 105,947,479 probably benign Het
Slx4 C T 16: 3,988,000 A72T probably benign Het
Snrnp200 T C 2: 127,238,063 I1920T probably damaging Het
Stap2 C T 17: 55,999,976 V234M probably damaging Het
Sv2b A G 7: 75,117,741 F636L probably benign Het
Tdp1 C T 12: 99,935,052 T531I probably benign Het
Thra G A 11: 98,764,352 V353I probably benign Het
Tm7sf2 A G 19: 6,066,422 probably benign Het
Tmx4 A T 2: 134,600,998 probably null Het
Tnfrsf12a A G 17: 23,676,145 probably null Het
Trav6n-5 T A 14: 53,104,911 M14K probably benign Het
Ttn T A 2: 76,742,280 I26090F probably damaging Het
Tut1 G T 19: 8,962,759 R369L probably benign Het
Uba5 T A 9: 104,054,148 T241S probably benign Het
Unc13d T C 11: 116,069,165 T597A probably benign Het
Vmn1r58 A T 7: 5,410,388 I281K probably damaging Het
Vmn1r59 A G 7: 5,454,434 V109A probably benign Het
Xdh T A 17: 73,907,632 M773L probably benign Het
Zfp64 A T 2: 168,925,715 I659N possibly damaging Het
Other mutations in Olfr486
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0144:Olfr486 UTSW 7 108171971 missense probably benign 0.00
R0165:Olfr486 UTSW 7 108172675 missense probably benign 0.03
R0739:Olfr486 UTSW 7 108172010 missense probably benign 0.00
R1027:Olfr486 UTSW 7 108172141 missense probably damaging 0.98
R1781:Olfr486 UTSW 7 108171883 missense probably benign 0.06
R3729:Olfr486 UTSW 7 108172309 missense probably benign 0.13
R4505:Olfr486 UTSW 7 108171968 missense probably benign 0.00
R5223:Olfr486 UTSW 7 108172708 missense probably benign 0.20
R7089:Olfr486 UTSW 7 108172494 missense probably benign 0.01
R7499:Olfr486 UTSW 7 108171800 makesense probably null
R7894:Olfr486 UTSW 7 108172184 missense probably benign
R7995:Olfr486 UTSW 7 108172000 missense probably damaging 1.00
R8807:Olfr486 UTSW 7 108172645 missense possibly damaging 0.93
R9050:Olfr486 UTSW 7 108171880 missense probably damaging 1.00
R9244:Olfr486 UTSW 7 108172645 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GGCCAAAGGAGAAATACCTTGGCTT -3'
(R):5'- AGCAATCTGCAACCCACTGCTTTAT -3'

Sequencing Primer
(F):5'- GGAGAAATACCTTGGCTTATAACC -3'
(R):5'- ATGTCCTCACAAGTGTGTATCCAG -3'
Posted On 2013-08-06