Incidental Mutation 'R8352:1700123K08Rik'
ID645558
Institutional Source Beutler Lab
Gene Symbol 1700123K08Rik
Ensembl Gene ENSMUSG00000029526
Gene NameRIKEN cDNA 1700123K08 gene
Synonyms
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_029693.2; MGI:1923908

Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R8352 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location138561840-138564712 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 138562926 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 158 (T158M)
Ref Sequence ENSEMBL: ENSMUSP00000031501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031501]
Predicted Effect probably benign
Transcript: ENSMUST00000031501
AA Change: T158M

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000031501
Gene: ENSMUSG00000029526
AA Change: T158M

DomainStartEndE-ValueType
SCOP:d1bkds_ 48 165 6e-22 SMART
Blast:RasGEFN 66 182 2e-57 BLAST
low complexity region 263 282 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7b T A 4: 56,740,251 D369V probably damaging Het
Apc A G 18: 34,312,751 D900G possibly damaging Het
Bola1 G A 3: 96,197,257 A7V probably benign Het
Bud13 A G 9: 46,288,079 N246S possibly damaging Het
Cdkal1 G A 13: 29,354,680 P499S probably benign Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Cntnap5c C T 17: 58,055,692 R347W probably damaging Het
Cox8b T A 7: 140,899,016 E62V probably null Het
Cyp2t4 G A 7: 27,157,737 A342T probably benign Het
Cyp8b1 A G 9: 121,915,931 Y112H probably damaging Het
Dlg5 G T 14: 24,191,193 A212D probably damaging Het
Dnah7a T C 1: 53,427,827 E3626G probably null Het
Dpys T C 15: 39,793,324 E449G possibly damaging Het
Fam187a C A 11: 102,886,574 C401* probably null Het
Fsip2 A T 2: 82,984,593 I3557L probably benign Het
Gpr165 C A X: 96,714,017 D7E probably benign Het
Hist1h2bf A G 13: 23,574,045 V49A probably damaging Het
Ifi213 T C 1: 173,595,269 K10R possibly damaging Het
Lrrfip1 T C 1: 90,998,819 S8P probably benign Het
Morc2b T C 17: 33,137,502 D432G probably damaging Het
Mrgpra4 T A 7: 47,981,677 I59F probably damaging Het
Mttp A T 3: 138,112,613 D361E probably damaging Het
Mysm1 A G 4: 94,975,273 S28P probably damaging Het
Nrd1 T A 4: 109,019,063 V284D probably damaging Het
Nrip2 A T 6: 128,407,994 D203V probably damaging Het
Olfr251 A T 9: 38,378,351 M151L probably benign Het
Olfr648 A T 7: 104,179,896 C171S probably damaging Het
Olfr658 A T 7: 104,644,529 V281E possibly damaging Het
Olfr832 T A 9: 18,945,163 L172M possibly damaging Het
Oog4 A T 4: 143,437,477 Y495N probably benign Het
Pacrg T A 17: 10,576,594 R146* probably null Het
Pcdh18 A T 3: 49,745,175 M946K possibly damaging Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pign A G 1: 105,648,192 I241T probably benign Het
Pik3cg A G 12: 32,193,640 I944T probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Ppp2r5c T A 12: 110,544,077 F99L probably benign Het
Prex1 A T 2: 166,589,573 N756K probably benign Het
Prex2 A T 1: 11,285,139 M1555L probably benign Het
Prex2 T G 1: 11,285,140 M1555R probably benign Het
Prl3c1 T A 13: 27,202,402 D123E probably benign Het
Prr22 G A 17: 56,771,311 G155R probably damaging Het
Rev3l A G 10: 39,822,903 D1132G probably damaging Het
Rnf180 A T 13: 105,181,548 F452Y probably damaging Het
Scn4b A T 9: 45,146,741 I44F possibly damaging Het
Sirpb1b T A 3: 15,542,350 I291L probably benign Het
Slc12a9 C A 5: 137,315,475 V741L probably benign Het
Tbc1d8 G T 1: 39,405,357 R174S probably damaging Het
Tenm2 A G 11: 36,023,601 F2370L probably damaging Het
Tfec T A 6: 16,844,203 H115L probably damaging Het
Tnxb A T 17: 34,689,407 T1345S probably damaging Het
Ttn T A 2: 76,738,487 N27354I probably damaging Het
Unc13c A G 9: 73,931,008 Y854H probably damaging Het
Utrn A T 10: 12,813,509 W11R probably benign Het
Vmn2r26 A G 6: 124,039,618 Q347R probably benign Het
Other mutations in 1700123K08Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:1700123K08Rik APN 5 138562489 missense probably benign 0.01
IGL02318:1700123K08Rik APN 5 138563576 missense probably damaging 1.00
IGL02451:1700123K08Rik APN 5 138563547 missense probably damaging 1.00
IGL03263:1700123K08Rik APN 5 138564237 missense probably damaging 0.98
P0016:1700123K08Rik UTSW 5 138562938 nonsense probably null
R0686:1700123K08Rik UTSW 5 138564537 missense possibly damaging 0.70
R2051:1700123K08Rik UTSW 5 138564185 missense probably damaging 1.00
R2055:1700123K08Rik UTSW 5 138562845 missense probably damaging 0.99
R2185:1700123K08Rik UTSW 5 138563567 missense probably damaging 1.00
R2761:1700123K08Rik UTSW 5 138564174 missense possibly damaging 0.72
R4233:1700123K08Rik UTSW 5 138564192 missense probably damaging 1.00
R5610:1700123K08Rik UTSW 5 138564141 critical splice donor site probably null
R7136:1700123K08Rik UTSW 5 138562348 missense probably damaging 0.98
R7365:1700123K08Rik UTSW 5 138562936 missense probably benign 0.34
R8130:1700123K08Rik UTSW 5 138563009 missense probably damaging 0.98
R8347:1700123K08Rik UTSW 5 138562891 missense probably benign 0.00
R8350:1700123K08Rik UTSW 5 138562926 missense probably benign 0.02
R8351:1700123K08Rik UTSW 5 138562926 missense probably benign 0.02
R8450:1700123K08Rik UTSW 5 138562926 missense probably benign 0.02
R8451:1700123K08Rik UTSW 5 138562926 missense probably benign 0.02
R8452:1700123K08Rik UTSW 5 138562926 missense probably benign 0.02
R8475:1700123K08Rik UTSW 5 138562926 missense probably benign 0.02
Z1176:1700123K08Rik UTSW 5 138563553 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTCTGGAGAATACCCCGG -3'
(R):5'- ACCACTATGCTCATCTGCAG -3'

Sequencing Primer
(F):5'- TCTGGAGAATACCCCGGTGAAATC -3'
(R):5'- TATGCTCATCTGCAGACAGG -3'
Posted On2020-09-02