Incidental Mutation 'R8352:Vmn2r26'
ID 645560
Institutional Source Beutler Lab
Gene Symbol Vmn2r26
Ensembl Gene ENSMUSG00000096630
Gene Name vomeronasal 2, receptor 26
Synonyms V2r1b
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock # R8352 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 124024758-124062035 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 124039618 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 347 (Q347R)
Ref Sequence ENSEMBL: ENSMUSP00000032238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032238]
AlphaFold Q6TAC4
Predicted Effect probably benign
Transcript: ENSMUST00000032238
AA Change: Q347R

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000032238
Gene: ENSMUSG00000096630
AA Change: Q347R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 471 1.5e-31 PFAM
Pfam:NCD3G 519 572 4.6e-25 PFAM
Pfam:7tm_3 603 840 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vomeronasal sensory neuron physiology and avnosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik G A 5: 138,562,926 T158M probably benign Het
Actl7b T A 4: 56,740,251 D369V probably damaging Het
Apc A G 18: 34,312,751 D900G possibly damaging Het
Bola1 G A 3: 96,197,257 A7V probably benign Het
Bud13 A G 9: 46,288,079 N246S possibly damaging Het
Cdkal1 G A 13: 29,354,680 P499S probably benign Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Cntnap5c C T 17: 58,055,692 R347W probably damaging Het
Cox8b T A 7: 140,899,016 E62V probably null Het
Cyp2t4 G A 7: 27,157,737 A342T probably benign Het
Cyp8b1 A G 9: 121,915,931 Y112H probably damaging Het
Dlg5 G T 14: 24,191,193 A212D probably damaging Het
Dnah7a T C 1: 53,427,827 E3626G probably null Het
Dpys T C 15: 39,793,324 E449G possibly damaging Het
Fam187a C A 11: 102,886,574 C401* probably null Het
Fsip2 A T 2: 82,984,593 I3557L probably benign Het
Gpr165 C A X: 96,714,017 D7E probably benign Het
Hist1h2bf A G 13: 23,574,045 V49A probably damaging Het
Ifi213 T C 1: 173,595,269 K10R possibly damaging Het
Lrrfip1 T C 1: 90,998,819 S8P probably benign Het
Morc2b T C 17: 33,137,502 D432G probably damaging Het
Mrgpra4 T A 7: 47,981,677 I59F probably damaging Het
Mttp A T 3: 138,112,613 D361E probably damaging Het
Mysm1 A G 4: 94,975,273 S28P probably damaging Het
Nrd1 T A 4: 109,019,063 V284D probably damaging Het
Nrip2 A T 6: 128,407,994 D203V probably damaging Het
Olfr251 A T 9: 38,378,351 M151L probably benign Het
Olfr648 A T 7: 104,179,896 C171S probably damaging Het
Olfr658 A T 7: 104,644,529 V281E possibly damaging Het
Olfr832 T A 9: 18,945,163 L172M possibly damaging Het
Oog4 A T 4: 143,437,477 Y495N probably benign Het
Pacrg T A 17: 10,576,594 R146* probably null Het
Pcdh18 A T 3: 49,745,175 M946K possibly damaging Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pign A G 1: 105,648,192 I241T probably benign Het
Pik3cg A G 12: 32,193,640 I944T probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Ppp2r5c T A 12: 110,544,077 F99L probably benign Het
Prex1 A T 2: 166,589,573 N756K probably benign Het
Prex2 A T 1: 11,285,139 M1555L probably benign Het
Prex2 T G 1: 11,285,140 M1555R probably benign Het
Prl3c1 T A 13: 27,202,402 D123E probably benign Het
Prr22 G A 17: 56,771,311 G155R probably damaging Het
Rev3l A G 10: 39,822,903 D1132G probably damaging Het
Rnf180 A T 13: 105,181,548 F452Y probably damaging Het
Scn4b A T 9: 45,146,741 I44F possibly damaging Het
Sirpb1b T A 3: 15,542,350 I291L probably benign Het
Slc12a9 C A 5: 137,315,475 V741L probably benign Het
Tbc1d8 G T 1: 39,405,357 R174S probably damaging Het
Tenm2 A G 11: 36,023,601 F2370L probably damaging Het
Tfec T A 6: 16,844,203 H115L probably damaging Het
Tnxb A T 17: 34,689,407 T1345S probably damaging Het
Ttn T A 2: 76,738,487 N27354I probably damaging Het
Unc13c A G 9: 73,931,008 Y854H probably damaging Het
Utrn A T 10: 12,813,509 W11R probably benign Het
Other mutations in Vmn2r26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Vmn2r26 APN 6 124061607 missense probably benign 0.00
IGL01370:Vmn2r26 APN 6 124061756 missense probably benign 0.08
IGL01603:Vmn2r26 APN 6 124053874 missense probably damaging 1.00
IGL01651:Vmn2r26 APN 6 124050673 missense probably benign 0.01
IGL02282:Vmn2r26 APN 6 124061625 missense probably damaging 1.00
IGL02425:Vmn2r26 APN 6 124061818 missense probably damaging 1.00
IGL02551:Vmn2r26 APN 6 124026141 missense probably benign 0.11
IGL02690:Vmn2r26 APN 6 124026132 missense probably benign 0.14
IGL03002:Vmn2r26 APN 6 124039795 missense possibly damaging 0.78
IGL03270:Vmn2r26 APN 6 124050819 missense probably benign 0.16
R0032:Vmn2r26 UTSW 6 124039899 missense possibly damaging 0.72
R0052:Vmn2r26 UTSW 6 124062033 makesense probably null
R0083:Vmn2r26 UTSW 6 124053981 splice site probably null
R0682:Vmn2r26 UTSW 6 124061170 missense probably damaging 0.97
R1061:Vmn2r26 UTSW 6 124061644 missense probably benign 0.12
R1077:Vmn2r26 UTSW 6 124053913 missense probably benign 0.00
R1263:Vmn2r26 UTSW 6 124050708 missense probably benign
R1579:Vmn2r26 UTSW 6 124039747 missense probably benign 0.00
R1741:Vmn2r26 UTSW 6 124061472 missense probably damaging 1.00
R1834:Vmn2r26 UTSW 6 124061410 missense possibly damaging 0.54
R1838:Vmn2r26 UTSW 6 124024771 missense probably benign
R1956:Vmn2r26 UTSW 6 124053887 missense probably damaging 1.00
R1996:Vmn2r26 UTSW 6 124061185 missense probably damaging 1.00
R2140:Vmn2r26 UTSW 6 124061237 missense probably benign 0.01
R2327:Vmn2r26 UTSW 6 124039749 missense probably benign 0.07
R2417:Vmn2r26 UTSW 6 124061350 missense probably damaging 1.00
R3930:Vmn2r26 UTSW 6 124025979 missense probably benign
R4490:Vmn2r26 UTSW 6 124050738 missense possibly damaging 0.47
R4629:Vmn2r26 UTSW 6 124061191 missense possibly damaging 0.50
R4655:Vmn2r26 UTSW 6 124061416 missense probably damaging 1.00
R4709:Vmn2r26 UTSW 6 124053965 missense probably damaging 1.00
R4992:Vmn2r26 UTSW 6 124026111 missense probably benign 0.00
R5297:Vmn2r26 UTSW 6 124061873 missense probably damaging 1.00
R5482:Vmn2r26 UTSW 6 124061326 missense possibly damaging 0.88
R5517:Vmn2r26 UTSW 6 124050717 missense probably damaging 1.00
R5737:Vmn2r26 UTSW 6 124039449 missense probably benign 0.00
R5739:Vmn2r26 UTSW 6 124025966 missense probably benign 0.00
R5873:Vmn2r26 UTSW 6 124061674 missense probably benign 0.01
R5907:Vmn2r26 UTSW 6 124039871 missense probably benign 0.00
R6086:Vmn2r26 UTSW 6 124039560 missense possibly damaging 0.48
R6134:Vmn2r26 UTSW 6 124061485 missense probably damaging 0.97
R6391:Vmn2r26 UTSW 6 124061389 missense probably damaging 1.00
R6428:Vmn2r26 UTSW 6 124026080 missense probably benign 0.17
R6637:Vmn2r26 UTSW 6 124061691 missense probably damaging 1.00
R6927:Vmn2r26 UTSW 6 124039098 missense possibly damaging 0.93
R6953:Vmn2r26 UTSW 6 124039782 missense probably benign 0.00
R7173:Vmn2r26 UTSW 6 124061296 missense probably benign 0.16
R7206:Vmn2r26 UTSW 6 124039768 missense probably benign 0.17
R7208:Vmn2r26 UTSW 6 124061989 missense probably damaging 1.00
R7283:Vmn2r26 UTSW 6 124025955 missense probably damaging 0.97
R7506:Vmn2r26 UTSW 6 124039741 missense probably benign 0.00
R7672:Vmn2r26 UTSW 6 124039647 missense probably benign 0.25
R7674:Vmn2r26 UTSW 6 124039362 missense probably benign
R7696:Vmn2r26 UTSW 6 124061535 missense possibly damaging 0.94
R7716:Vmn2r26 UTSW 6 124061745 missense probably damaging 1.00
R7831:Vmn2r26 UTSW 6 124039799 nonsense probably null
R8063:Vmn2r26 UTSW 6 124024955 missense probably benign 0.00
R8331:Vmn2r26 UTSW 6 124061928 missense probably benign 0.22
R8445:Vmn2r26 UTSW 6 124026036 missense probably damaging 0.97
R8452:Vmn2r26 UTSW 6 124039618 missense probably benign 0.09
R8681:Vmn2r26 UTSW 6 124024918 missense probably benign 0.00
R8914:Vmn2r26 UTSW 6 124062024 missense probably benign
R9333:Vmn2r26 UTSW 6 124026050 missense probably benign 0.13
R9351:Vmn2r26 UTSW 6 124039374 missense probably benign
R9436:Vmn2r26 UTSW 6 124025867 missense probably damaging 1.00
R9515:Vmn2r26 UTSW 6 124061178 missense probably damaging 1.00
RF010:Vmn2r26 UTSW 6 124039489 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ACTGTTGGAGACACACATTCTC -3'
(R):5'- CAGCAGCATAGACTTTGTAGC -3'

Sequencing Primer
(F):5'- GGAGACACACATTCTCTTCTGCG -3'
(R):5'- GCAGCATAGACTTTGTAGCTATAGG -3'
Posted On 2020-09-02