Incidental Mutation 'R8352:Vmn2r26'
ID 645560
Institutional Source Beutler Lab
Gene Symbol Vmn2r26
Ensembl Gene ENSMUSG00000096630
Gene Name vomeronasal 2, receptor 26
Synonyms V2r1b
MMRRC Submission 067733-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R8352 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 124001717-124038994 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 124016577 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 347 (Q347R)
Ref Sequence ENSEMBL: ENSMUSP00000032238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032238]
AlphaFold Q6TAC4
Predicted Effect probably benign
Transcript: ENSMUST00000032238
AA Change: Q347R

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000032238
Gene: ENSMUSG00000096630
AA Change: Q347R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 471 1.5e-31 PFAM
Pfam:NCD3G 519 572 4.6e-25 PFAM
Pfam:7tm_3 603 840 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vomeronasal sensory neuron physiology and avnosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik G A 5: 138,561,188 (GRCm39) T158M probably benign Het
Actl7b T A 4: 56,740,251 (GRCm39) D369V probably damaging Het
Apc A G 18: 34,445,804 (GRCm39) D900G possibly damaging Het
Bola1 G A 3: 96,104,573 (GRCm39) A7V probably benign Het
Bud13 A G 9: 46,199,377 (GRCm39) N246S possibly damaging Het
Cdkal1 G A 13: 29,538,663 (GRCm39) P499S probably benign Het
Celsr1 G T 15: 85,917,286 (GRCm39) S229* probably null Het
Cntnap5c C T 17: 58,362,687 (GRCm39) R347W probably damaging Het
Cox8b T A 7: 140,478,929 (GRCm39) E62V probably null Het
Cyp2t4 G A 7: 26,857,162 (GRCm39) A342T probably benign Het
Cyp8b1 A G 9: 121,744,997 (GRCm39) Y112H probably damaging Het
Dlg5 G T 14: 24,241,261 (GRCm39) A212D probably damaging Het
Dnah7a T C 1: 53,466,986 (GRCm39) E3626G probably null Het
Dpys T C 15: 39,656,720 (GRCm39) E449G possibly damaging Het
Fam187a C A 11: 102,777,400 (GRCm39) C401* probably null Het
Fsip2 A T 2: 82,814,937 (GRCm39) I3557L probably benign Het
Gpr165 C A X: 95,757,623 (GRCm39) D7E probably benign Het
H2bc7 A G 13: 23,758,219 (GRCm39) V49A probably damaging Het
Ifi213 T C 1: 173,422,835 (GRCm39) K10R possibly damaging Het
Lrrfip1 T C 1: 90,926,541 (GRCm39) S8P probably benign Het
Morc2b T C 17: 33,356,476 (GRCm39) D432G probably damaging Het
Mrgpra4 T A 7: 47,631,425 (GRCm39) I59F probably damaging Het
Mttp A T 3: 137,818,374 (GRCm39) D361E probably damaging Het
Mysm1 A G 4: 94,863,510 (GRCm39) S28P probably damaging Het
Nrdc T A 4: 108,876,260 (GRCm39) V284D probably damaging Het
Nrip2 A T 6: 128,384,957 (GRCm39) D203V probably damaging Het
Oog4 A T 4: 143,164,047 (GRCm39) Y495N probably benign Het
Or52h1 A T 7: 103,829,103 (GRCm39) C171S probably damaging Het
Or52n4 A T 7: 104,293,736 (GRCm39) V281E possibly damaging Het
Or7g19 T A 9: 18,856,459 (GRCm39) L172M possibly damaging Het
Or8c11 A T 9: 38,289,647 (GRCm39) M151L probably benign Het
Pacrg T A 17: 10,795,523 (GRCm39) R146* probably null Het
Pcdh18 A T 3: 49,699,624 (GRCm39) M946K possibly damaging Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,302,525 (GRCm39) probably benign Het
Pign A G 1: 105,575,917 (GRCm39) I241T probably benign Het
Pik3cg A G 12: 32,243,639 (GRCm39) I944T probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Ppp2r5c T A 12: 110,510,511 (GRCm39) F99L probably benign Het
Prex1 A T 2: 166,431,493 (GRCm39) N756K probably benign Het
Prex2 A T 1: 11,355,363 (GRCm39) M1555L probably benign Het
Prex2 T G 1: 11,355,364 (GRCm39) M1555R probably benign Het
Prl3c1 T A 13: 27,386,385 (GRCm39) D123E probably benign Het
Prr22 G A 17: 57,078,311 (GRCm39) G155R probably damaging Het
Rev3l A G 10: 39,698,899 (GRCm39) D1132G probably damaging Het
Rnf180 A T 13: 105,318,056 (GRCm39) F452Y probably damaging Het
Scn4b A T 9: 45,058,039 (GRCm39) I44F possibly damaging Het
Sirpb1b T A 3: 15,607,410 (GRCm39) I291L probably benign Het
Slc12a9 C A 5: 137,313,737 (GRCm39) V741L probably benign Het
Tbc1d8 G T 1: 39,444,438 (GRCm39) R174S probably damaging Het
Tenm2 A G 11: 35,914,428 (GRCm39) F2370L probably damaging Het
Tfec T A 6: 16,844,202 (GRCm39) H115L probably damaging Het
Tnxb A T 17: 34,908,381 (GRCm39) T1345S probably damaging Het
Ttn T A 2: 76,568,831 (GRCm39) N27354I probably damaging Het
Unc13c A G 9: 73,838,290 (GRCm39) Y854H probably damaging Het
Utrn A T 10: 12,689,253 (GRCm39) W11R probably benign Het
Other mutations in Vmn2r26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Vmn2r26 APN 6 124,038,566 (GRCm39) missense probably benign 0.00
IGL01370:Vmn2r26 APN 6 124,038,715 (GRCm39) missense probably benign 0.08
IGL01603:Vmn2r26 APN 6 124,030,833 (GRCm39) missense probably damaging 1.00
IGL01651:Vmn2r26 APN 6 124,027,632 (GRCm39) missense probably benign 0.01
IGL02282:Vmn2r26 APN 6 124,038,584 (GRCm39) missense probably damaging 1.00
IGL02425:Vmn2r26 APN 6 124,038,777 (GRCm39) missense probably damaging 1.00
IGL02551:Vmn2r26 APN 6 124,003,100 (GRCm39) missense probably benign 0.11
IGL02690:Vmn2r26 APN 6 124,003,091 (GRCm39) missense probably benign 0.14
IGL03002:Vmn2r26 APN 6 124,016,754 (GRCm39) missense possibly damaging 0.78
IGL03270:Vmn2r26 APN 6 124,027,778 (GRCm39) missense probably benign 0.16
R0032:Vmn2r26 UTSW 6 124,016,858 (GRCm39) missense possibly damaging 0.72
R0052:Vmn2r26 UTSW 6 124,038,992 (GRCm39) makesense probably null
R0083:Vmn2r26 UTSW 6 124,030,940 (GRCm39) splice site probably null
R0682:Vmn2r26 UTSW 6 124,038,129 (GRCm39) missense probably damaging 0.97
R1061:Vmn2r26 UTSW 6 124,038,603 (GRCm39) missense probably benign 0.12
R1077:Vmn2r26 UTSW 6 124,030,872 (GRCm39) missense probably benign 0.00
R1263:Vmn2r26 UTSW 6 124,027,667 (GRCm39) missense probably benign
R1579:Vmn2r26 UTSW 6 124,016,706 (GRCm39) missense probably benign 0.00
R1741:Vmn2r26 UTSW 6 124,038,431 (GRCm39) missense probably damaging 1.00
R1834:Vmn2r26 UTSW 6 124,038,369 (GRCm39) missense possibly damaging 0.54
R1838:Vmn2r26 UTSW 6 124,001,730 (GRCm39) missense probably benign
R1956:Vmn2r26 UTSW 6 124,030,846 (GRCm39) missense probably damaging 1.00
R1996:Vmn2r26 UTSW 6 124,038,144 (GRCm39) missense probably damaging 1.00
R2140:Vmn2r26 UTSW 6 124,038,196 (GRCm39) missense probably benign 0.01
R2327:Vmn2r26 UTSW 6 124,016,708 (GRCm39) missense probably benign 0.07
R2417:Vmn2r26 UTSW 6 124,038,309 (GRCm39) missense probably damaging 1.00
R3930:Vmn2r26 UTSW 6 124,002,938 (GRCm39) missense probably benign
R4490:Vmn2r26 UTSW 6 124,027,697 (GRCm39) missense possibly damaging 0.47
R4629:Vmn2r26 UTSW 6 124,038,150 (GRCm39) missense possibly damaging 0.50
R4655:Vmn2r26 UTSW 6 124,038,375 (GRCm39) missense probably damaging 1.00
R4709:Vmn2r26 UTSW 6 124,030,924 (GRCm39) missense probably damaging 1.00
R4992:Vmn2r26 UTSW 6 124,003,070 (GRCm39) missense probably benign 0.00
R5297:Vmn2r26 UTSW 6 124,038,832 (GRCm39) missense probably damaging 1.00
R5482:Vmn2r26 UTSW 6 124,038,285 (GRCm39) missense possibly damaging 0.88
R5517:Vmn2r26 UTSW 6 124,027,676 (GRCm39) missense probably damaging 1.00
R5737:Vmn2r26 UTSW 6 124,016,408 (GRCm39) missense probably benign 0.00
R5739:Vmn2r26 UTSW 6 124,002,925 (GRCm39) missense probably benign 0.00
R5873:Vmn2r26 UTSW 6 124,038,633 (GRCm39) missense probably benign 0.01
R5907:Vmn2r26 UTSW 6 124,016,830 (GRCm39) missense probably benign 0.00
R6086:Vmn2r26 UTSW 6 124,016,519 (GRCm39) missense possibly damaging 0.48
R6134:Vmn2r26 UTSW 6 124,038,444 (GRCm39) missense probably damaging 0.97
R6391:Vmn2r26 UTSW 6 124,038,348 (GRCm39) missense probably damaging 1.00
R6428:Vmn2r26 UTSW 6 124,003,039 (GRCm39) missense probably benign 0.17
R6637:Vmn2r26 UTSW 6 124,038,650 (GRCm39) missense probably damaging 1.00
R6927:Vmn2r26 UTSW 6 124,016,057 (GRCm39) missense possibly damaging 0.93
R6953:Vmn2r26 UTSW 6 124,016,741 (GRCm39) missense probably benign 0.00
R7173:Vmn2r26 UTSW 6 124,038,255 (GRCm39) missense probably benign 0.16
R7206:Vmn2r26 UTSW 6 124,016,727 (GRCm39) missense probably benign 0.17
R7208:Vmn2r26 UTSW 6 124,038,948 (GRCm39) missense probably damaging 1.00
R7283:Vmn2r26 UTSW 6 124,002,914 (GRCm39) missense probably damaging 0.97
R7506:Vmn2r26 UTSW 6 124,016,700 (GRCm39) missense probably benign 0.00
R7672:Vmn2r26 UTSW 6 124,016,606 (GRCm39) missense probably benign 0.25
R7674:Vmn2r26 UTSW 6 124,016,321 (GRCm39) missense probably benign
R7696:Vmn2r26 UTSW 6 124,038,494 (GRCm39) missense possibly damaging 0.94
R7716:Vmn2r26 UTSW 6 124,038,704 (GRCm39) missense probably damaging 1.00
R7831:Vmn2r26 UTSW 6 124,016,758 (GRCm39) nonsense probably null
R8063:Vmn2r26 UTSW 6 124,001,914 (GRCm39) missense probably benign 0.00
R8331:Vmn2r26 UTSW 6 124,038,887 (GRCm39) missense probably benign 0.22
R8445:Vmn2r26 UTSW 6 124,002,995 (GRCm39) missense probably damaging 0.97
R8452:Vmn2r26 UTSW 6 124,016,577 (GRCm39) missense probably benign 0.09
R8681:Vmn2r26 UTSW 6 124,001,877 (GRCm39) missense probably benign 0.00
R8914:Vmn2r26 UTSW 6 124,038,983 (GRCm39) missense probably benign
R9333:Vmn2r26 UTSW 6 124,003,009 (GRCm39) missense probably benign 0.13
R9351:Vmn2r26 UTSW 6 124,016,333 (GRCm39) missense probably benign
R9436:Vmn2r26 UTSW 6 124,002,826 (GRCm39) missense probably damaging 1.00
R9515:Vmn2r26 UTSW 6 124,038,137 (GRCm39) missense probably damaging 1.00
RF010:Vmn2r26 UTSW 6 124,016,448 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ACTGTTGGAGACACACATTCTC -3'
(R):5'- CAGCAGCATAGACTTTGTAGC -3'

Sequencing Primer
(F):5'- GGAGACACACATTCTCTTCTGCG -3'
(R):5'- GCAGCATAGACTTTGTAGCTATAGG -3'
Posted On 2020-09-02