Incidental Mutation 'R8352:Prr22'
ID645590
Institutional Source Beutler Lab
Gene Symbol Prr22
Ensembl Gene ENSMUSG00000090273
Gene Nameproline rich 22
SynonymsLOC224908, Gm546
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R8352 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location56770250-56772208 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 56771311 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 155 (G155R)
Ref Sequence ENSEMBL: ENSMUSP00000127457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002444] [ENSMUST00000007747] [ENSMUST00000086801] [ENSMUST00000168666]
Predicted Effect probably benign
Transcript: ENSMUST00000002444
SMART Domains Protein: ENSMUSP00000002444
Gene: ENSMUSG00000024206

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 4 149 1.9e-50 PFAM
Pfam:RFX_DNA_binding 192 269 4.3e-36 PFAM
Blast:HisKA 479 542 1e-31 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000007747
SMART Domains Protein: ENSMUSP00000007747
Gene: ENSMUSG00000007603

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Blast:ZnF_C3H1 109 136 2e-6 BLAST
Blast:ZnF_C3H1 146 172 6e-9 BLAST
Pfam:Dus 295 566 2e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086801
SMART Domains Protein: ENSMUSP00000084010
Gene: ENSMUSG00000024206

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 1 151 6.8e-56 PFAM
Pfam:RFX_DNA_binding 161 246 6e-41 PFAM
Blast:HisKA 454 517 1e-31 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000168666
AA Change: G155R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127457
Gene: ENSMUSG00000090273
AA Change: G155R

DomainStartEndE-ValueType
low complexity region 22 35 N/A INTRINSIC
Pfam:PRR22 58 422 2.3e-169 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik G A 5: 138,562,926 T158M probably benign Het
Actl7b T A 4: 56,740,251 D369V probably damaging Het
Apc A G 18: 34,312,751 D900G possibly damaging Het
Bola1 G A 3: 96,197,257 A7V probably benign Het
Bud13 A G 9: 46,288,079 N246S possibly damaging Het
Cdkal1 G A 13: 29,354,680 P499S probably benign Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Cntnap5c C T 17: 58,055,692 R347W probably damaging Het
Cox8b T A 7: 140,899,016 E62V probably null Het
Cyp2t4 G A 7: 27,157,737 A342T probably benign Het
Cyp8b1 A G 9: 121,915,931 Y112H probably damaging Het
Dlg5 G T 14: 24,191,193 A212D probably damaging Het
Dnah7a T C 1: 53,427,827 E3626G probably null Het
Dpys T C 15: 39,793,324 E449G possibly damaging Het
Fam187a C A 11: 102,886,574 C401* probably null Het
Fsip2 A T 2: 82,984,593 I3557L probably benign Het
Gpr165 C A X: 96,714,017 D7E probably benign Het
Hist1h2bf A G 13: 23,574,045 V49A probably damaging Het
Ifi213 T C 1: 173,595,269 K10R possibly damaging Het
Lrrfip1 T C 1: 90,998,819 S8P probably benign Het
Morc2b T C 17: 33,137,502 D432G probably damaging Het
Mrgpra4 T A 7: 47,981,677 I59F probably damaging Het
Mttp A T 3: 138,112,613 D361E probably damaging Het
Mysm1 A G 4: 94,975,273 S28P probably damaging Het
Nrd1 T A 4: 109,019,063 V284D probably damaging Het
Nrip2 A T 6: 128,407,994 D203V probably damaging Het
Olfr251 A T 9: 38,378,351 M151L probably benign Het
Olfr648 A T 7: 104,179,896 C171S probably damaging Het
Olfr658 A T 7: 104,644,529 V281E possibly damaging Het
Olfr832 T A 9: 18,945,163 L172M possibly damaging Het
Oog4 A T 4: 143,437,477 Y495N probably benign Het
Pacrg T A 17: 10,576,594 R146* probably null Het
Pcdh18 A T 3: 49,745,175 M946K possibly damaging Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pign A G 1: 105,648,192 I241T probably benign Het
Pik3cg A G 12: 32,193,640 I944T probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Ppp2r5c T A 12: 110,544,077 F99L probably benign Het
Prex1 A T 2: 166,589,573 N756K probably benign Het
Prex2 A T 1: 11,285,139 M1555L probably benign Het
Prex2 T G 1: 11,285,140 M1555R probably benign Het
Prl3c1 T A 13: 27,202,402 D123E probably benign Het
Rev3l A G 10: 39,822,903 D1132G probably damaging Het
Rnf180 A T 13: 105,181,548 F452Y probably damaging Het
Scn4b A T 9: 45,146,741 I44F possibly damaging Het
Sirpb1b T A 3: 15,542,350 I291L probably benign Het
Slc12a9 C A 5: 137,315,475 V741L probably benign Het
Tbc1d8 G T 1: 39,405,357 R174S probably damaging Het
Tenm2 A G 11: 36,023,601 F2370L probably damaging Het
Tfec T A 6: 16,844,203 H115L probably damaging Het
Tnxb A T 17: 34,689,407 T1345S probably damaging Het
Ttn T A 2: 76,738,487 N27354I probably damaging Het
Unc13c A G 9: 73,931,008 Y854H probably damaging Het
Utrn A T 10: 12,813,509 W11R probably benign Het
Vmn2r26 A G 6: 124,039,618 Q347R probably benign Het
Other mutations in Prr22
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0462:Prr22 UTSW 17 56770551 unclassified probably benign
R0787:Prr22 UTSW 17 56771072 missense possibly damaging 0.71
R2290:Prr22 UTSW 17 56771884 missense probably benign
R4749:Prr22 UTSW 17 56771274 missense possibly damaging 0.51
R5099:Prr22 UTSW 17 56771467 missense probably benign 0.32
R6268:Prr22 UTSW 17 56771587 missense probably damaging 0.98
R6339:Prr22 UTSW 17 56771490 missense probably benign 0.02
R6542:Prr22 UTSW 17 56770527 splice site probably null
R6951:Prr22 UTSW 17 56772028 nonsense probably null
R6991:Prr22 UTSW 17 56771345 missense possibly damaging 0.92
R7721:Prr22 UTSW 17 56771819 missense possibly damaging 0.92
R8452:Prr22 UTSW 17 56771311 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACAAAGTGGCAGTGGCTGG -3'
(R):5'- CATCTTCGAGAAGGACCTTGTC -3'

Sequencing Primer
(F):5'- CTGGGGGTCCTGCCTTGTC -3'
(R):5'- TCAATGGGCCTCATGGTCAC -3'
Posted On2020-09-02