Incidental Mutation 'R8353:Mmrn1'
ID645605
Institutional Source Beutler Lab
Gene Symbol Mmrn1
Ensembl Gene ENSMUSG00000054641
Gene Namemultimerin 1
Synonyms4921530G03Rik, Emilin4
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8353 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location60924976-60989378 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 60988377 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 1131 (Y1131N)
Ref Sequence ENSEMBL: ENSMUSP00000119609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129603] [ENSMUST00000204333]
Predicted Effect probably damaging
Transcript: ENSMUST00000129603
AA Change: Y1131N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119609
Gene: ENSMUSG00000054641
AA Change: Y1131N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
Pfam:EMI 193 262 3.3e-12 PFAM
coiled coil region 303 338 N/A INTRINSIC
coiled coil region 658 688 N/A INTRINSIC
coiled coil region 808 846 N/A INTRINSIC
low complexity region 981 992 N/A INTRINSIC
EGF 1026 1059 1.62e-5 SMART
C1Q 1076 1210 6.74e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000204333
AA Change: Y1130N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145156
Gene: ENSMUSG00000054641
AA Change: Y1130N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
Pfam:EMI 193 262 7.7e-13 PFAM
coiled coil region 303 338 N/A INTRINSIC
coiled coil region 658 688 N/A INTRINSIC
coiled coil region 808 846 N/A INTRINSIC
low complexity region 981 992 N/A INTRINSIC
EGF 1025 1058 1.62e-5 SMART
C1Q 1075 1209 6.74e-49 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding protein and may function as a carrier protein for platelet factor V. It may also have functions as an extracellular matrix or adhesive protein. Recently, patients with an unusual autosomal-dominant bleeding disorder (factor V Quebec) were found to have a deficiency of platelet multimerin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik A T 5: 90,566,501 R123S possibly damaging Het
8030462N17Rik T C 18: 77,673,908 E236G probably damaging Het
9630041A04Rik G T 9: 101,938,685 C23F possibly damaging Het
Adam29 T C 8: 55,873,161 H86R possibly damaging Het
Alas1 C T 9: 106,236,522 R508Q possibly damaging Het
Bmp3 G A 5: 98,855,423 probably null Het
Bud13 A G 9: 46,288,201 T287A probably benign Het
C3 T C 17: 57,212,643 E1203G probably benign Het
Carmil2 A C 8: 105,690,211 Q476P probably damaging Het
Ccdc187 T A 2: 26,276,446 T707S probably damaging Het
Cfap43 A T 19: 47,746,647 V1435E probably damaging Het
Chrm3 A T 13: 9,877,231 *590K probably null Het
Commd1 C T 11: 22,978,503 probably benign Het
Creb3l1 A T 2: 91,990,929 Y314* probably null Het
Ctc1 T A 11: 69,022,449 S90R probably benign Het
Dixdc1 T C 9: 50,684,886 Q413R probably benign Het
Dlg5 T C 14: 24,158,145 T998A probably benign Het
Fam89b A G 19: 5,728,875 S99P possibly damaging Het
Fbxo30 A G 10: 11,290,735 I400M probably benign Het
Gad1 A T 2: 70,600,713 M567L probably benign Het
Gemin5 T C 11: 58,125,239 S1314G probably benign Het
Gm2035 C T 12: 87,919,553 S102N probably benign Het
Gm9195 T G 14: 72,440,761 I2323L probably benign Het
Gria1 T A 11: 57,243,051 F585L probably damaging Het
Hbs1l A T 10: 21,309,279 H200L probably benign Het
Igsf5 A G 16: 96,421,796 Q360R probably benign Het
Il31ra A T 13: 112,524,183 V624E probably damaging Het
Iqsec3 T C 6: 121,387,820 R837G probably damaging Het
Lpl A G 8: 68,895,781 I221V probably damaging Het
Mink1 T A 11: 70,610,328 D887E possibly damaging Het
Mmp10 T G 9: 7,508,202 F443C probably damaging Het
Mrc2 T A 11: 105,332,311 V460E probably damaging Het
Nicn1 T A 9: 108,293,373 F57Y probably damaging Het
Nlrp4b A G 7: 10,715,601 Y577C probably damaging Het
Nrap T C 19: 56,323,920 T1535A probably damaging Het
Opa1 G A 16: 29,620,868 R755H probably damaging Het
Phldb2 A G 16: 45,825,022 S354P probably benign Het
Phykpl T C 11: 51,598,294 S316P probably damaging Het
Pnpla1 T A 17: 28,858,899 D11E probably benign Het
Pold2 A G 11: 5,875,104 F98L probably damaging Het
Prph G A 15: 99,056,776 R241Q probably benign Het
Rcl1 T C 19: 29,115,759 I58T possibly damaging Het
Rps6ka2 A G 17: 7,246,752 N117D probably benign Het
Sars G A 3: 108,428,713 S331L probably benign Het
Scfd1 A C 12: 51,412,591 K312Q possibly damaging Het
Senp5 A G 16: 31,989,348 C363R probably benign Het
Senp7 A G 16: 56,188,328 I1024V probably damaging Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sptbn4 A G 7: 27,404,238 L1191P probably damaging Het
Ssfa2 T C 2: 79,644,785 S363P probably benign Het
Stk40 A G 4: 126,128,973 E180G probably damaging Het
Stxbp5 A T 10: 9,809,048 V536E probably benign Het
Tex15 G T 8: 33,576,871 E2110* probably null Het
Thbs4 G A 13: 92,790,817 P55S probably benign Het
Tmem115 T C 9: 107,534,798 V107A probably benign Het
Tnfaip6 A C 2: 52,055,867 I242L probably benign Het
Trabd G T 15: 89,085,413 A270S possibly damaging Het
Trim30d T A 7: 104,487,740 I86F probably damaging Het
Trpc7 A G 13: 56,822,559 V404A probably benign Het
Vmn1r61 A G 7: 5,610,887 Y143H probably benign Het
Vmn2r18 T A 5: 151,561,908 D707V probably damaging Het
Vnn3 G A 10: 23,869,545 R464H probably benign Het
Wdr27 T C 17: 14,892,489 T652A probably benign Het
Wdr78 A G 4: 103,059,916 I577T possibly damaging Het
Yeats2 C T 16: 20,222,887 R1176* probably null Het
Other mutations in Mmrn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00640:Mmrn1 APN 6 60977513 missense probably benign
IGL00742:Mmrn1 APN 6 60958120 missense probably damaging 1.00
IGL00917:Mmrn1 APN 6 60975910 nonsense probably null
IGL01121:Mmrn1 APN 6 60975944 missense possibly damaging 0.46
IGL01393:Mmrn1 APN 6 60960708 splice site probably benign
IGL01697:Mmrn1 APN 6 60976493 missense possibly damaging 0.46
IGL01737:Mmrn1 APN 6 60977161 missense probably benign
IGL01944:Mmrn1 APN 6 60971183 critical splice donor site probably null
IGL01987:Mmrn1 APN 6 60944573 missense probably benign 0.31
IGL02005:Mmrn1 APN 6 60960744 missense probably damaging 1.00
IGL02190:Mmrn1 APN 6 60987193 missense probably benign 0.13
IGL02335:Mmrn1 APN 6 60977147 missense possibly damaging 0.79
IGL02421:Mmrn1 APN 6 60944822 missense probably benign 0.00
IGL02530:Mmrn1 APN 6 60958176 missense possibly damaging 0.73
IGL02709:Mmrn1 APN 6 60973046 missense probably damaging 1.00
IGL03139:Mmrn1 APN 6 60976340 missense probably damaging 0.99
IGL03228:Mmrn1 APN 6 60944892 missense probably benign 0.02
IGL03272:Mmrn1 APN 6 60988435 missense probably damaging 1.00
IGL03410:Mmrn1 APN 6 60975835 missense probably benign 0.36
H8562:Mmrn1 UTSW 6 60958180 missense probably damaging 0.98
K2124:Mmrn1 UTSW 6 60976033 missense possibly damaging 0.87
R0145:Mmrn1 UTSW 6 60973010 missense probably damaging 1.00
R0164:Mmrn1 UTSW 6 60975815 splice site probably benign
R0352:Mmrn1 UTSW 6 60944971 missense probably benign 0.03
R0400:Mmrn1 UTSW 6 60977115 missense probably benign 0.00
R0538:Mmrn1 UTSW 6 60976469 missense probably benign 0.00
R0907:Mmrn1 UTSW 6 60973119 missense probably benign 0.09
R1117:Mmrn1 UTSW 6 60976325 missense possibly damaging 0.51
R1383:Mmrn1 UTSW 6 60976322 missense probably damaging 1.00
R1542:Mmrn1 UTSW 6 60945118 missense probably damaging 0.98
R1591:Mmrn1 UTSW 6 60944771 nonsense probably null
R1599:Mmrn1 UTSW 6 60945037 missense probably benign
R1733:Mmrn1 UTSW 6 60977101 missense probably benign 0.00
R2005:Mmrn1 UTSW 6 60976084 missense possibly damaging 0.88
R2056:Mmrn1 UTSW 6 60944805 missense probably benign 0.00
R2144:Mmrn1 UTSW 6 60945075 missense possibly damaging 0.54
R2299:Mmrn1 UTSW 6 60976441 missense probably damaging 0.99
R3836:Mmrn1 UTSW 6 60944847 missense probably benign
R3837:Mmrn1 UTSW 6 60944847 missense probably benign
R4206:Mmrn1 UTSW 6 60958180 missense probably damaging 0.98
R4414:Mmrn1 UTSW 6 60944586 missense probably damaging 1.00
R4590:Mmrn1 UTSW 6 60960813 missense probably damaging 1.00
R4707:Mmrn1 UTSW 6 60988473 missense probably benign 0.12
R4820:Mmrn1 UTSW 6 60973043 missense probably benign 0.04
R4880:Mmrn1 UTSW 6 60976439 missense probably benign 0.15
R5166:Mmrn1 UTSW 6 60976490 missense probably benign 0.04
R5324:Mmrn1 UTSW 6 60976586 missense probably damaging 1.00
R5887:Mmrn1 UTSW 6 60987074 missense probably benign
R5917:Mmrn1 UTSW 6 60973150 critical splice donor site probably null
R6108:Mmrn1 UTSW 6 60975976 missense possibly damaging 0.83
R6539:Mmrn1 UTSW 6 60987184 missense probably benign 0.01
R6996:Mmrn1 UTSW 6 60977383 missense probably benign 0.04
R7064:Mmrn1 UTSW 6 60988540 nonsense probably null
R7073:Mmrn1 UTSW 6 60988427 missense probably damaging 1.00
R7213:Mmrn1 UTSW 6 60944543 start gained probably benign
R7256:Mmrn1 UTSW 6 60976114 missense probably damaging 0.98
R7324:Mmrn1 UTSW 6 60944933 nonsense probably null
R7350:Mmrn1 UTSW 6 60976336 nonsense probably null
R7388:Mmrn1 UTSW 6 60976252 missense probably benign 0.43
R7652:Mmrn1 UTSW 6 60977506 missense probably benign 0.14
R7664:Mmrn1 UTSW 6 60976705 missense probably benign 0.44
R7810:Mmrn1 UTSW 6 60976325 missense probably benign 0.18
R7832:Mmrn1 UTSW 6 60987060 splice site probably null
R7979:Mmrn1 UTSW 6 60975977 missense probably damaging 0.96
R8071:Mmrn1 UTSW 6 60944524 start gained probably benign
R8130:Mmrn1 UTSW 6 60960723 missense probably damaging 1.00
R8277:Mmrn1 UTSW 6 60977236 missense probably benign 0.19
R8453:Mmrn1 UTSW 6 60988377 missense probably damaging 1.00
X0026:Mmrn1 UTSW 6 60976013 missense probably benign 0.09
Z1176:Mmrn1 UTSW 6 60945034 missense probably benign 0.37
Z1177:Mmrn1 UTSW 6 60987098 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TCCAAAGGATCTTACAGATATGCTCC -3'
(R):5'- TCTCACACAAACTTAGGTGCG -3'

Sequencing Primer
(F):5'- AGGATCTTACAGATATGCTCCGATGG -3'
(R):5'- CACTGAACGTGGTCACAGG -3'
Posted On2020-09-02