Incidental Mutation 'R8353:Stxbp5'
ID645623
Institutional Source Beutler Lab
Gene Symbol Stxbp5
Ensembl Gene ENSMUSG00000019790
Gene Namesyntaxin binding protein 5 (tomosyn)
Synonyms4930565N16Rik, 0710001E20Rik, LGL3, tomosyn 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8353 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location9755547-9901079 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 9809048 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 536 (V536E)
Ref Sequence ENSEMBL: ENSMUSP00000044535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038213] [ENSMUST00000125200] [ENSMUST00000141722]
Predicted Effect probably benign
Transcript: ENSMUST00000038213
AA Change: V536E

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000044535
Gene: ENSMUSG00000019790
AA Change: V536E

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 276 385 2e-36 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
Pfam:Lgl_C 771 1050 2.7e-8 PFAM
PDB:1URQ|A 1086 1145 2e-33 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000125200
AA Change: V536E

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000121507
Gene: ENSMUSG00000019790
AA Change: V536E

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 273 385 1.6e-46 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 722 730 N/A INTRINSIC
Pfam:Lgl_C 839 994 1.9e-8 PFAM
PDB:1URQ|A 1033 1092 2e-33 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000141722
AA Change: V536E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000123253
Gene: ENSMUSG00000019790
AA Change: V536E

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 273 385 1.7e-46 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 739 747 N/A INTRINSIC
Pfam:Lgl_C 856 1011 2e-8 PFAM
PDB:1URQ|A 1050 1109 2e-33 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Syntaxin 1 is a component of the 7S and 20S SNARE complexes which are involved in docking and fusion of synaptic vesicles with the presynaptic plasma membrane. This gene encodes a syntaxin 1 binding protein. In rat, a similar protein dissociates syntaxin 1 from the Munc18/n-Sec1/rbSec1 complex to form a 10S complex, an intermediate which can be converted to the 7S SNARE complex. Thus this protein is thought to be involved in neurotransmitter release by stimulating SNARE complex formation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some background sensitive prenatal lethality and increased synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik A T 5: 90,566,501 R123S possibly damaging Het
8030462N17Rik T C 18: 77,673,908 E236G probably damaging Het
9630041A04Rik G T 9: 101,938,685 C23F possibly damaging Het
Adam29 T C 8: 55,873,161 H86R possibly damaging Het
Alas1 C T 9: 106,236,522 R508Q possibly damaging Het
Bmp3 G A 5: 98,855,423 probably null Het
Bud13 A G 9: 46,288,201 T287A probably benign Het
C3 T C 17: 57,212,643 E1203G probably benign Het
Carmil2 A C 8: 105,690,211 Q476P probably damaging Het
Ccdc187 T A 2: 26,276,446 T707S probably damaging Het
Cfap43 A T 19: 47,746,647 V1435E probably damaging Het
Chrm3 A T 13: 9,877,231 *590K probably null Het
Commd1 C T 11: 22,978,503 probably benign Het
Creb3l1 A T 2: 91,990,929 Y314* probably null Het
Ctc1 T A 11: 69,022,449 S90R probably benign Het
Dixdc1 T C 9: 50,684,886 Q413R probably benign Het
Dlg5 T C 14: 24,158,145 T998A probably benign Het
Fam89b A G 19: 5,728,875 S99P possibly damaging Het
Fbxo30 A G 10: 11,290,735 I400M probably benign Het
Gad1 A T 2: 70,600,713 M567L probably benign Het
Gemin5 T C 11: 58,125,239 S1314G probably benign Het
Gm2035 C T 12: 87,919,553 S102N probably benign Het
Gm9195 T G 14: 72,440,761 I2323L probably benign Het
Gria1 T A 11: 57,243,051 F585L probably damaging Het
Hbs1l A T 10: 21,309,279 H200L probably benign Het
Igsf5 A G 16: 96,421,796 Q360R probably benign Het
Il31ra A T 13: 112,524,183 V624E probably damaging Het
Iqsec3 T C 6: 121,387,820 R837G probably damaging Het
Lpl A G 8: 68,895,781 I221V probably damaging Het
Mink1 T A 11: 70,610,328 D887E possibly damaging Het
Mmp10 T G 9: 7,508,202 F443C probably damaging Het
Mmrn1 T A 6: 60,988,377 Y1131N probably damaging Het
Mrc2 T A 11: 105,332,311 V460E probably damaging Het
Nicn1 T A 9: 108,293,373 F57Y probably damaging Het
Nlrp4b A G 7: 10,715,601 Y577C probably damaging Het
Nrap T C 19: 56,323,920 T1535A probably damaging Het
Opa1 G A 16: 29,620,868 R755H probably damaging Het
Phldb2 A G 16: 45,825,022 S354P probably benign Het
Phykpl T C 11: 51,598,294 S316P probably damaging Het
Pnpla1 T A 17: 28,858,899 D11E probably benign Het
Pold2 A G 11: 5,875,104 F98L probably damaging Het
Prph G A 15: 99,056,776 R241Q probably benign Het
Rcl1 T C 19: 29,115,759 I58T possibly damaging Het
Rps6ka2 A G 17: 7,246,752 N117D probably benign Het
Sars G A 3: 108,428,713 S331L probably benign Het
Scfd1 A C 12: 51,412,591 K312Q possibly damaging Het
Senp5 A G 16: 31,989,348 C363R probably benign Het
Senp7 A G 16: 56,188,328 I1024V probably damaging Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sptbn4 A G 7: 27,404,238 L1191P probably damaging Het
Ssfa2 T C 2: 79,644,785 S363P probably benign Het
Stk40 A G 4: 126,128,973 E180G probably damaging Het
Tex15 G T 8: 33,576,871 E2110* probably null Het
Thbs4 G A 13: 92,790,817 P55S probably benign Het
Tmem115 T C 9: 107,534,798 V107A probably benign Het
Tnfaip6 A C 2: 52,055,867 I242L probably benign Het
Trabd G T 15: 89,085,413 A270S possibly damaging Het
Trim30d T A 7: 104,487,740 I86F probably damaging Het
Trpc7 A G 13: 56,822,559 V404A probably benign Het
Vmn1r61 A G 7: 5,610,887 Y143H probably benign Het
Vmn2r18 T A 5: 151,561,908 D707V probably damaging Het
Vnn3 G A 10: 23,869,545 R464H probably benign Het
Wdr27 T C 17: 14,892,489 T652A probably benign Het
Wdr78 A G 4: 103,059,916 I577T possibly damaging Het
Yeats2 C T 16: 20,222,887 R1176* probably null Het
Other mutations in Stxbp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Stxbp5 APN 10 9799950 missense probably damaging 1.00
IGL00950:Stxbp5 APN 10 9808602 splice site probably benign
IGL01725:Stxbp5 APN 10 9817411 missense probably damaging 1.00
IGL02150:Stxbp5 APN 10 9762821 missense probably damaging 1.00
IGL02339:Stxbp5 APN 10 9816297 missense possibly damaging 0.89
IGL02697:Stxbp5 APN 10 9762956 nonsense probably null
IGL02720:Stxbp5 APN 10 9789361 critical splice donor site probably null
IGL03155:Stxbp5 APN 10 9816290 missense probably null 1.00
IGL03288:Stxbp5 APN 10 9866703 splice site probably null
Fatty_fish UTSW 10 9770551 missense probably damaging 1.00
reindeer UTSW 10 9838092 missense probably damaging 1.00
H8562:Stxbp5 UTSW 10 9769443 missense probably benign 0.36
PIT4544001:Stxbp5 UTSW 10 9817304 critical splice donor site probably null
R0025:Stxbp5 UTSW 10 9762748 missense probably damaging 1.00
R0025:Stxbp5 UTSW 10 9762748 missense probably damaging 1.00
R0219:Stxbp5 UTSW 10 9770528 missense probably benign 0.36
R0226:Stxbp5 UTSW 10 9866698 splice site probably benign
R0631:Stxbp5 UTSW 10 9784358 missense probably benign
R0723:Stxbp5 UTSW 10 9768873 missense probably damaging 1.00
R0833:Stxbp5 UTSW 10 9865099 missense probably damaging 1.00
R0836:Stxbp5 UTSW 10 9865099 missense probably damaging 1.00
R0863:Stxbp5 UTSW 10 9809040 missense possibly damaging 0.86
R1225:Stxbp5 UTSW 10 9812391 missense possibly damaging 0.94
R1271:Stxbp5 UTSW 10 9816269 missense probably damaging 1.00
R1536:Stxbp5 UTSW 10 9838092 missense probably damaging 1.00
R1852:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R1884:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R1902:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R1917:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R1918:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R2174:Stxbp5 UTSW 10 9835846 missense possibly damaging 0.69
R3773:Stxbp5 UTSW 10 9768927 missense probably damaging 1.00
R3901:Stxbp5 UTSW 10 9769419 missense probably damaging 1.00
R3981:Stxbp5 UTSW 10 9789316 intron probably benign
R4572:Stxbp5 UTSW 10 9838144 missense probably damaging 0.99
R4764:Stxbp5 UTSW 10 9770623 missense probably damaging 1.00
R4841:Stxbp5 UTSW 10 9762891 missense probably benign 0.06
R4842:Stxbp5 UTSW 10 9762891 missense probably benign 0.06
R4884:Stxbp5 UTSW 10 9812341 nonsense probably null
R4887:Stxbp5 UTSW 10 9809100 missense probably benign
R4930:Stxbp5 UTSW 10 9760866 utr 3 prime probably benign
R5065:Stxbp5 UTSW 10 9770551 missense probably damaging 1.00
R5285:Stxbp5 UTSW 10 9798275 critical splice acceptor site probably null
R5306:Stxbp5 UTSW 10 9799991 missense probably damaging 1.00
R5455:Stxbp5 UTSW 10 9808508 missense probably benign
R5531:Stxbp5 UTSW 10 9762924 nonsense probably null
R5605:Stxbp5 UTSW 10 9769746 intron probably benign
R5614:Stxbp5 UTSW 10 9760894 utr 3 prime probably benign
R5805:Stxbp5 UTSW 10 9900586 missense probably benign
R5990:Stxbp5 UTSW 10 9835933 missense probably damaging 1.00
R6025:Stxbp5 UTSW 10 9800028 missense probably benign 0.00
R6056:Stxbp5 UTSW 10 9770686 missense probably benign 0.00
R6147:Stxbp5 UTSW 10 9808472 missense possibly damaging 0.93
R6194:Stxbp5 UTSW 10 9817339 missense probably damaging 0.99
R6284:Stxbp5 UTSW 10 9767179 missense probably benign 0.32
R6284:Stxbp5 UTSW 10 9767187 missense probably damaging 1.00
R6394:Stxbp5 UTSW 10 9899231 nonsense probably null
R6427:Stxbp5 UTSW 10 9899254 missense probably damaging 1.00
R6894:Stxbp5 UTSW 10 9784361 missense probably benign 0.00
R7229:Stxbp5 UTSW 10 9798187 missense probably damaging 1.00
R7337:Stxbp5 UTSW 10 9809130 missense possibly damaging 0.93
R7686:Stxbp5 UTSW 10 9769410 missense probably damaging 0.99
R7811:Stxbp5 UTSW 10 9808504 missense probably benign
R7974:Stxbp5 UTSW 10 9770695 splice site probably null
R8009:Stxbp5 UTSW 10 9816302 missense probably damaging 1.00
R8287:Stxbp5 UTSW 10 9784385 missense probably benign
R8360:Stxbp5 UTSW 10 9812259 critical splice donor site probably null
R8453:Stxbp5 UTSW 10 9809048 missense probably benign 0.30
R8487:Stxbp5 UTSW 10 9812289 missense possibly damaging 0.80
R8548:Stxbp5 UTSW 10 9817306 missense probably null 0.98
R8805:Stxbp5 UTSW 10 9838115 nonsense probably null
X0020:Stxbp5 UTSW 10 9762890 missense possibly damaging 0.47
Z1176:Stxbp5 UTSW 10 9900545 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GTGCACAATACACATCCTGC -3'
(R):5'- CAAAGGATGGAGGTTCTGGGTC -3'

Sequencing Primer
(F):5'- ACACATCCTGCCTTTCGAATAGATTG -3'
(R):5'- GTAGACAGAAATTATTGGTTGGCAC -3'
Posted On2020-09-02