Mutagenetix > Incidental Mutation

Incidental Mutation 'R8353:Stxbp5'

645623

Institutional Source

Beutler Lab

Gene Symbol

Stxbp5

Ensembl Gene

ENSMUSG00000019790

Gene Name

syntaxin binding protein 5 (tomosyn)

Synonyms

4930565N16Rik, 0710001E20Rik, LGL3, tomosyn 1

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8353 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

9755547-9901079 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 9809048 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 536 (V536E)

Ref Sequence

ENSEMBL: ENSMUSP00000044535 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038213] [ENSMUST00000125200] [ENSMUST00000141722]

AlphaFold

Q8K400

Predicted Effect

probably benign
Transcript: ENSMUST00000038213
AA Change: V536E

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000044535
Gene: ENSMUSG00000019790
AA Change: V536E

Domain	Start	End	E-Value	Type
low complexity region	17	28	N/A	INTRINSIC
WD40	46	86	2.21e1	SMART
WD40	88	127	5.94e0	SMART
WD40	132	171	1.97e2	SMART
WD40	185	225	1.99e0	SMART
WD40	228	266	5.69e-4	SMART
Pfam:LLGL	276	385	2e-36	PFAM
WD40	386	465	2.88e-1	SMART
WD40	491	530	3.68e1	SMART
low complexity region	572	591	N/A	INTRINSIC
low complexity region	713	724	N/A	INTRINSIC
Pfam:Lgl_C	771	1050	2.7e-8	PFAM
PDB:1URQ\|A	1086	1145	2e-33	PDB

Predicted Effect

possibly damaging
Transcript: ENSMUST00000125200
AA Change: V536E

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000121507
Gene: ENSMUSG00000019790
AA Change: V536E

Domain	Start	End	E-Value	Type
low complexity region	17	28	N/A	INTRINSIC
WD40	46	86	2.21e1	SMART
WD40	88	127	5.94e0	SMART
WD40	132	171	1.97e2	SMART
WD40	185	225	1.99e0	SMART
WD40	228	266	5.69e-4	SMART
Pfam:LLGL	273	385	1.6e-46	PFAM
WD40	386	465	2.88e-1	SMART
WD40	491	530	3.68e1	SMART
low complexity region	572	591	N/A	INTRINSIC
low complexity region	722	730	N/A	INTRINSIC
Pfam:Lgl_C	839	994	1.9e-8	PFAM
PDB:1URQ\|A	1033	1092	2e-33	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000141722
AA Change: V536E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000123253
Gene: ENSMUSG00000019790
AA Change: V536E

Domain	Start	End	E-Value	Type
low complexity region	17	28	N/A	INTRINSIC
WD40	46	86	2.21e1	SMART
WD40	88	127	5.94e0	SMART
WD40	132	171	1.97e2	SMART
WD40	185	225	1.99e0	SMART
WD40	228	266	5.69e-4	SMART
Pfam:LLGL	273	385	1.7e-46	PFAM
WD40	386	465	2.88e-1	SMART
WD40	491	530	3.68e1	SMART
low complexity region	572	591	N/A	INTRINSIC
low complexity region	739	747	N/A	INTRINSIC
Pfam:Lgl_C	856	1011	2e-8	PFAM
PDB:1URQ\|A	1050	1109	2e-33	PDB

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Syntaxin 1 is a component of the 7S and 20S SNARE complexes which are involved in docking and fusion of synaptic vesicles with the presynaptic plasma membrane. This gene encodes a syntaxin 1 binding protein. In rat, a similar protein dissociates syntaxin 1 from the Munc18/n-Sec1/rbSec1 complex to form a 10S complex, an intermediate which can be converted to the 7S SNARE complex. Thus this protein is thought to be involved in neurotransmitter release by stimulating SNARE complex formation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some background sensitive prenatal lethality and increased synaptic transmission. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5830473C10Rik	A	T	5: 90,566,501	R123S	possibly damaging	Het
8030462N17Rik	T	C	18: 77,673,908	E236G	probably damaging	Het
9630041A04Rik	G	T	9: 101,938,685	C23F	possibly damaging	Het
Adam29	T	C	8: 55,873,161	H86R	possibly damaging	Het
Alas1	C	T	9: 106,236,522	R508Q	possibly damaging	Het
Bmp3	G	A	5: 98,855,423		probably null	Het
Bud13	A	G	9: 46,288,201	T287A	probably benign	Het
C3	T	C	17: 57,212,643	E1203G	probably benign	Het
Carmil2	A	C	8: 105,690,211	Q476P	probably damaging	Het
Ccdc187	T	A	2: 26,276,446	T707S	probably damaging	Het
Cfap43	A	T	19: 47,746,647	V1435E	probably damaging	Het
Chrm3	A	T	13: 9,877,231	*590K	probably null	Het
Commd1	C	T	11: 22,978,503		probably benign	Het
Creb3l1	A	T	2: 91,990,929	Y314*	probably null	Het
Ctc1	T	A	11: 69,022,449	S90R	probably benign	Het
Dixdc1	T	C	9: 50,684,886	Q413R	probably benign	Het
Dlg5	T	C	14: 24,158,145	T998A	probably benign	Het
Fam89b	A	G	19: 5,728,875	S99P	possibly damaging	Het
Fbxo30	A	G	10: 11,290,735	I400M	probably benign	Het
Gad1	A	T	2: 70,600,713	M567L	probably benign	Het
Gemin5	T	C	11: 58,125,239	S1314G	probably benign	Het
Gm2035	C	T	12: 87,919,553	S102N	probably benign	Het
Gm9195	T	G	14: 72,440,761	I2323L	probably benign	Het
Gria1	T	A	11: 57,243,051	F585L	probably damaging	Het
Hbs1l	A	T	10: 21,309,279	H200L	probably benign	Het
Igsf5	A	G	16: 96,421,796	Q360R	probably benign	Het
Il31ra	A	T	13: 112,524,183	V624E	probably damaging	Het
Iqsec3	T	C	6: 121,387,820	R837G	probably damaging	Het
Lpl	A	G	8: 68,895,781	I221V	probably damaging	Het
Mink1	T	A	11: 70,610,328	D887E	possibly damaging	Het
Mmp10	T	G	9: 7,508,202	F443C	probably damaging	Het
Mmrn1	T	A	6: 60,988,377	Y1131N	probably damaging	Het
Mrc2	T	A	11: 105,332,311	V460E	probably damaging	Het
Nicn1	T	A	9: 108,293,373	F57Y	probably damaging	Het
Nlrp4b	A	G	7: 10,715,601	Y577C	probably damaging	Het
Nrap	T	C	19: 56,323,920	T1535A	probably damaging	Het
Opa1	G	A	16: 29,620,868	R755H	probably damaging	Het
Phldb2	A	G	16: 45,825,022	S354P	probably benign	Het
Phykpl	T	C	11: 51,598,294	S316P	probably damaging	Het
Pnpla1	T	A	17: 28,858,899	D11E	probably benign	Het
Pold2	A	G	11: 5,875,104	F98L	probably damaging	Het
Prph	G	A	15: 99,056,776	R241Q	probably benign	Het
Rcl1	T	C	19: 29,115,759	I58T	possibly damaging	Het
Rps6ka2	A	G	17: 7,246,752	N117D	probably benign	Het
Sars	G	A	3: 108,428,713	S331L	probably benign	Het
Scfd1	A	C	12: 51,412,591	K312Q	possibly damaging	Het
Senp5	A	G	16: 31,989,348	C363R	probably benign	Het
Senp7	A	G	16: 56,188,328	I1024V	probably damaging	Het
Sh2b1	TGGGGACCAGCTCAGCCACGGGGACCAGCTC	TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC	7: 126,467,570		probably benign	Het
Sptbn4	A	G	7: 27,404,238	L1191P	probably damaging	Het
Ssfa2	T	C	2: 79,644,785	S363P	probably benign	Het
Stk40	A	G	4: 126,128,973	E180G	probably damaging	Het
Tex15	G	T	8: 33,576,871	E2110*	probably null	Het
Thbs4	G	A	13: 92,790,817	P55S	probably benign	Het
Tmem115	T	C	9: 107,534,798	V107A	probably benign	Het
Tnfaip6	A	C	2: 52,055,867	I242L	probably benign	Het
Trabd	G	T	15: 89,085,413	A270S	possibly damaging	Het
Trim30d	T	A	7: 104,487,740	I86F	probably damaging	Het
Trpc7	A	G	13: 56,822,559	V404A	probably benign	Het
Vmn1r61	A	G	7: 5,610,887	Y143H	probably benign	Het
Vmn2r18	T	A	5: 151,561,908	D707V	probably damaging	Het
Vnn3	G	A	10: 23,869,545	R464H	probably benign	Het
Wdr27	T	C	17: 14,892,489	T652A	probably benign	Het
Wdr78	A	G	4: 103,059,916	I577T	possibly damaging	Het
Yeats2	C	T	16: 20,222,887	R1176*	probably null	Het

Other mutations in Stxbp5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00466:Stxbp5	APN	10	9799950	missense	probably damaging	1.00
IGL00950:Stxbp5	APN	10	9808602	splice site	probably benign
IGL01725:Stxbp5	APN	10	9817411	missense	probably damaging	1.00
IGL02150:Stxbp5	APN	10	9762821	missense	probably damaging	1.00
IGL02339:Stxbp5	APN	10	9816297	missense	possibly damaging	0.89
IGL02697:Stxbp5	APN	10	9762956	nonsense	probably null
IGL02720:Stxbp5	APN	10	9789361	critical splice donor site	probably null
IGL03155:Stxbp5	APN	10	9816290	missense	probably null	1.00
IGL03288:Stxbp5	APN	10	9866703	splice site	probably null
Fatty_fish	UTSW	10	9770551	missense	probably damaging	1.00
reindeer	UTSW	10	9838092	missense	probably damaging	1.00
H8562:Stxbp5	UTSW	10	9769443	missense	probably benign	0.36
PIT4544001:Stxbp5	UTSW	10	9817304	critical splice donor site	probably null
R0025:Stxbp5	UTSW	10	9762748	missense	probably damaging	1.00
R0025:Stxbp5	UTSW	10	9762748	missense	probably damaging	1.00
R0219:Stxbp5	UTSW	10	9770528	missense	probably benign	0.36
R0226:Stxbp5	UTSW	10	9866698	splice site	probably benign
R0631:Stxbp5	UTSW	10	9784358	missense	probably benign
R0723:Stxbp5	UTSW	10	9768873	missense	probably damaging	1.00
R0833:Stxbp5	UTSW	10	9865099	missense	probably damaging	1.00
R0836:Stxbp5	UTSW	10	9865099	missense	probably damaging	1.00
R0863:Stxbp5	UTSW	10	9809040	missense	possibly damaging	0.86
R1225:Stxbp5	UTSW	10	9812391	missense	possibly damaging	0.94
R1271:Stxbp5	UTSW	10	9816269	missense	probably damaging	1.00
R1536:Stxbp5	UTSW	10	9838092	missense	probably damaging	1.00
R1852:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R1884:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R1902:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R1917:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R1918:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R2174:Stxbp5	UTSW	10	9835846	missense	possibly damaging	0.69
R3773:Stxbp5	UTSW	10	9768927	missense	probably damaging	1.00
R3901:Stxbp5	UTSW	10	9769419	missense	probably damaging	1.00
R3981:Stxbp5	UTSW	10	9789316	intron	probably benign
R4572:Stxbp5	UTSW	10	9838144	missense	probably damaging	0.99
R4764:Stxbp5	UTSW	10	9770623	missense	probably damaging	1.00
R4841:Stxbp5	UTSW	10	9762891	missense	probably benign	0.06
R4842:Stxbp5	UTSW	10	9762891	missense	probably benign	0.06
R4884:Stxbp5	UTSW	10	9812341	nonsense	probably null
R4887:Stxbp5	UTSW	10	9809100	missense	probably benign
R4930:Stxbp5	UTSW	10	9760866	utr 3 prime	probably benign
R5065:Stxbp5	UTSW	10	9770551	missense	probably damaging	1.00
R5285:Stxbp5	UTSW	10	9798275	critical splice acceptor site	probably null
R5306:Stxbp5	UTSW	10	9799991	missense	probably damaging	1.00
R5455:Stxbp5	UTSW	10	9808508	missense	probably benign
R5531:Stxbp5	UTSW	10	9762924	nonsense	probably null
R5605:Stxbp5	UTSW	10	9769746	intron	probably benign
R5614:Stxbp5	UTSW	10	9760894	utr 3 prime	probably benign
R5805:Stxbp5	UTSW	10	9900586	missense	probably benign
R5990:Stxbp5	UTSW	10	9835933	missense	probably damaging	1.00
R6025:Stxbp5	UTSW	10	9800028	missense	probably benign	0.00
R6056:Stxbp5	UTSW	10	9770686	missense	probably benign	0.00
R6147:Stxbp5	UTSW	10	9808472	missense	possibly damaging	0.93
R6194:Stxbp5	UTSW	10	9817339	missense	probably damaging	0.99
R6284:Stxbp5	UTSW	10	9767179	missense	probably benign	0.32
R6284:Stxbp5	UTSW	10	9767187	missense	probably damaging	1.00
R6394:Stxbp5	UTSW	10	9899231	nonsense	probably null
R6427:Stxbp5	UTSW	10	9899254	missense	probably damaging	1.00
R6894:Stxbp5	UTSW	10	9784361	missense	probably benign	0.00
R7229:Stxbp5	UTSW	10	9798187	missense	probably damaging	1.00
R7337:Stxbp5	UTSW	10	9809130	missense	possibly damaging	0.93
R7686:Stxbp5	UTSW	10	9769410	missense	probably damaging	0.99
R7811:Stxbp5	UTSW	10	9808504	missense	probably benign
R7974:Stxbp5	UTSW	10	9770695	splice site	probably null
R8009:Stxbp5	UTSW	10	9816302	missense	probably damaging	1.00
R8287:Stxbp5	UTSW	10	9784385	missense	probably benign
R8360:Stxbp5	UTSW	10	9812259	critical splice donor site	probably null
R8453:Stxbp5	UTSW	10	9809048	missense	probably benign	0.30
R8487:Stxbp5	UTSW	10	9812289	missense	possibly damaging	0.80
R8548:Stxbp5	UTSW	10	9817306	missense	probably null	0.98
R8805:Stxbp5	UTSW	10	9838115	nonsense	probably null
R9172:Stxbp5	UTSW	10	9769408	missense	possibly damaging	0.94
R9472:Stxbp5	UTSW	10	9843357	missense	probably damaging	1.00
R9513:Stxbp5	UTSW	10	9812010	missense	probably benign	0.17
R9649:Stxbp5	UTSW	10	9899194	missense	probably damaging	0.96
X0020:Stxbp5	UTSW	10	9762890	missense	possibly damaging	0.47
Z1176:Stxbp5	UTSW	10	9900545	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- GTGCACAATACACATCCTGC -3'
(R):5'- CAAAGGATGGAGGTTCTGGGTC -3'

Sequencing Primer
(F):5'- ACACATCCTGCCTTTCGAATAGATTG -3'
(R):5'- GTAGACAGAAATTATTGGTTGGCAC -3'

Posted On

2020-09-02