Incidental Mutation 'R8353:Opa1'
ID645646
Institutional Source Beutler Lab
Gene Symbol Opa1
Ensembl Gene ENSMUSG00000038084
Gene NameOPA1, mitochondrial dynamin like GTPase
Synonyms1200011N24Rik, lilr3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8353 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location29579334-29654884 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 29620868 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 755 (R755H)
Ref Sequence ENSEMBL: ENSMUSP00000124223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038867] [ENSMUST00000160475] [ENSMUST00000160597] [ENSMUST00000161186]
Predicted Effect probably damaging
Transcript: ENSMUST00000038867
AA Change: R773H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000036993
Gene: ENSMUSG00000038084
AA Change: R773H

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
low complexity region 91 101 N/A INTRINSIC
low complexity region 189 205 N/A INTRINSIC
coiled coil region 228 271 N/A INTRINSIC
DYNc 283 533 2.18e-10 SMART
coiled coil region 918 967 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160475
SMART Domains Protein: ENSMUSP00000124739
Gene: ENSMUSG00000038084

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
low complexity region 91 101 N/A INTRINSIC
low complexity region 189 205 N/A INTRINSIC
coiled coil region 228 271 N/A INTRINSIC
DYNc 283 533 2.18e-10 SMART
Blast:DYNc 608 632 1e-5 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000160597
AA Change: R755H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124223
Gene: ENSMUSG00000038084
AA Change: R755H

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
low complexity region 91 101 N/A INTRINSIC
coiled coil region 210 253 N/A INTRINSIC
DYNc 265 515 2.18e-10 SMART
coiled coil region 900 949 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161186
AA Change: R792H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123880
Gene: ENSMUSG00000038084
AA Change: R792H

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
low complexity region 91 101 N/A INTRINSIC
coiled coil region 207 290 N/A INTRINSIC
DYNc 302 552 2.18e-10 SMART
coiled coil region 937 986 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a nuclear-encoded mitochondrial protein with similarity to dynamin-related GTPases. It is a component of the mitochondrial network. Mutations in this gene have been associated with optic atrophy type 1, which is a dominantly inherited optic neuropathy resulting in progressive loss of visual acuity, leading in many cases to legal blindness. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for an ENU mutation exhibit embryonic lethality, embryonic growth retardation and morphological abnormalities. Mice heterozygous for an ENU mutation exhibit abnormal cellular morphology, altered optic nerve myelination, abnormal responseto a new environment and decreased vision. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik A T 5: 90,566,501 R123S possibly damaging Het
8030462N17Rik T C 18: 77,673,908 E236G probably damaging Het
9630041A04Rik G T 9: 101,938,685 C23F possibly damaging Het
Adam29 T C 8: 55,873,161 H86R possibly damaging Het
Alas1 C T 9: 106,236,522 R508Q possibly damaging Het
Bmp3 G A 5: 98,855,423 probably null Het
Bud13 A G 9: 46,288,201 T287A probably benign Het
C3 T C 17: 57,212,643 E1203G probably benign Het
Carmil2 A C 8: 105,690,211 Q476P probably damaging Het
Ccdc187 T A 2: 26,276,446 T707S probably damaging Het
Cfap43 A T 19: 47,746,647 V1435E probably damaging Het
Chrm3 A T 13: 9,877,231 *590K probably null Het
Commd1 C T 11: 22,978,503 probably benign Het
Creb3l1 A T 2: 91,990,929 Y314* probably null Het
Ctc1 T A 11: 69,022,449 S90R probably benign Het
Dixdc1 T C 9: 50,684,886 Q413R probably benign Het
Dlg5 T C 14: 24,158,145 T998A probably benign Het
Fam89b A G 19: 5,728,875 S99P possibly damaging Het
Fbxo30 A G 10: 11,290,735 I400M probably benign Het
Gad1 A T 2: 70,600,713 M567L probably benign Het
Gemin5 T C 11: 58,125,239 S1314G probably benign Het
Gm2035 C T 12: 87,919,553 S102N probably benign Het
Gm9195 T G 14: 72,440,761 I2323L probably benign Het
Gria1 T A 11: 57,243,051 F585L probably damaging Het
Hbs1l A T 10: 21,309,279 H200L probably benign Het
Igsf5 A G 16: 96,421,796 Q360R probably benign Het
Il31ra A T 13: 112,524,183 V624E probably damaging Het
Iqsec3 T C 6: 121,387,820 R837G probably damaging Het
Lpl A G 8: 68,895,781 I221V probably damaging Het
Mink1 T A 11: 70,610,328 D887E possibly damaging Het
Mmp10 T G 9: 7,508,202 F443C probably damaging Het
Mmrn1 T A 6: 60,988,377 Y1131N probably damaging Het
Mrc2 T A 11: 105,332,311 V460E probably damaging Het
Nicn1 T A 9: 108,293,373 F57Y probably damaging Het
Nlrp4b A G 7: 10,715,601 Y577C probably damaging Het
Nrap T C 19: 56,323,920 T1535A probably damaging Het
Phldb2 A G 16: 45,825,022 S354P probably benign Het
Phykpl T C 11: 51,598,294 S316P probably damaging Het
Pnpla1 T A 17: 28,858,899 D11E probably benign Het
Pold2 A G 11: 5,875,104 F98L probably damaging Het
Prph G A 15: 99,056,776 R241Q probably benign Het
Rcl1 T C 19: 29,115,759 I58T possibly damaging Het
Rps6ka2 A G 17: 7,246,752 N117D probably benign Het
Sars G A 3: 108,428,713 S331L probably benign Het
Scfd1 A C 12: 51,412,591 K312Q possibly damaging Het
Senp5 A G 16: 31,989,348 C363R probably benign Het
Senp7 A G 16: 56,188,328 I1024V probably damaging Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sptbn4 A G 7: 27,404,238 L1191P probably damaging Het
Ssfa2 T C 2: 79,644,785 S363P probably benign Het
Stk40 A G 4: 126,128,973 E180G probably damaging Het
Stxbp5 A T 10: 9,809,048 V536E probably benign Het
Tex15 G T 8: 33,576,871 E2110* probably null Het
Thbs4 G A 13: 92,790,817 P55S probably benign Het
Tmem115 T C 9: 107,534,798 V107A probably benign Het
Tnfaip6 A C 2: 52,055,867 I242L probably benign Het
Trabd G T 15: 89,085,413 A270S possibly damaging Het
Trim30d T A 7: 104,487,740 I86F probably damaging Het
Trpc7 A G 13: 56,822,559 V404A probably benign Het
Vmn1r61 A G 7: 5,610,887 Y143H probably benign Het
Vmn2r18 T A 5: 151,561,908 D707V probably damaging Het
Vnn3 G A 10: 23,869,545 R464H probably benign Het
Wdr27 T C 17: 14,892,489 T652A probably benign Het
Wdr78 A G 4: 103,059,916 I577T possibly damaging Het
Yeats2 C T 16: 20,222,887 R1176* probably null Het
Other mutations in Opa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01082:Opa1 APN 16 29618115 splice site probably benign
IGL01087:Opa1 APN 16 29586997 missense probably damaging 1.00
IGL01799:Opa1 APN 16 29616658 missense possibly damaging 0.61
IGL01927:Opa1 APN 16 29586995 missense probably benign 0.35
IGL02067:Opa1 APN 16 29616655 missense probably damaging 1.00
IGL02317:Opa1 APN 16 29615166 critical splice donor site probably null
IGL02567:Opa1 APN 16 29588286 missense probably benign 0.01
IGL02826:Opa1 APN 16 29610887 missense probably null
Longshanks UTSW 16 29618259 missense probably damaging 1.00
R0032:Opa1 UTSW 16 29615069 missense probably damaging 1.00
R0032:Opa1 UTSW 16 29615069 missense probably damaging 1.00
R0092:Opa1 UTSW 16 29625594 missense probably damaging 0.99
R0114:Opa1 UTSW 16 29629635 missense probably benign 0.35
R0200:Opa1 UTSW 16 29614129 missense probably benign 0.08
R0308:Opa1 UTSW 16 29621531 missense probably damaging 0.98
R0427:Opa1 UTSW 16 29611461 missense probably damaging 0.98
R0671:Opa1 UTSW 16 29602207 splice site probably benign
R1768:Opa1 UTSW 16 29620810 missense probably benign
R1889:Opa1 UTSW 16 29625585 missense possibly damaging 0.67
R3932:Opa1 UTSW 16 29610880 missense probably damaging 1.00
R3933:Opa1 UTSW 16 29610880 missense probably damaging 1.00
R4434:Opa1 UTSW 16 29611983 missense probably damaging 1.00
R4618:Opa1 UTSW 16 29587039 missense probably damaging 1.00
R4926:Opa1 UTSW 16 29648973 missense possibly damaging 0.94
R5163:Opa1 UTSW 16 29597620 missense probably damaging 0.99
R5249:Opa1 UTSW 16 29618259 missense probably damaging 1.00
R5266:Opa1 UTSW 16 29618130 missense probably benign 0.19
R5275:Opa1 UTSW 16 29611579 missense probably damaging 1.00
R5372:Opa1 UTSW 16 29586119 missense probably benign 0.00
R5990:Opa1 UTSW 16 29587018 missense probably damaging 0.99
R6054:Opa1 UTSW 16 29615134 missense probably damaging 1.00
R6483:Opa1 UTSW 16 29628707 missense possibly damaging 0.72
R6522:Opa1 UTSW 16 29625514 missense probably benign 0.06
R6889:Opa1 UTSW 16 29620868 missense probably benign 0.22
R7225:Opa1 UTSW 16 29614039 splice site probably null
R7243:Opa1 UTSW 16 29586996 missense probably benign 0.01
R7324:Opa1 UTSW 16 29586981 missense probably benign
R7831:Opa1 UTSW 16 29648937 missense probably benign 0.02
R8304:Opa1 UTSW 16 29597671 missense possibly damaging 0.80
R8317:Opa1 UTSW 16 29614144 missense probably damaging 1.00
R8453:Opa1 UTSW 16 29620868 missense probably damaging 0.99
R8795:Opa1 UTSW 16 29629632 missense probably damaging 1.00
RF012:Opa1 UTSW 16 29613966 missense probably damaging 1.00
T0722:Opa1 UTSW 16 29610930 critical splice donor site probably null
X0065:Opa1 UTSW 16 29620784 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GTGGGAGTAACCTACTGTTAAGCG -3'
(R):5'- TGGCAAAAGTATGATAACTGTGTGG -3'

Sequencing Primer
(F):5'- GTAACCTACTGTTAAGCGGTTATTTG -3'
(R):5'- GATTTGGACGTGCACACAC -3'
Posted On2020-09-02