Incidental Mutation 'R8353:Rps6ka2'
ID645651
Institutional Source Beutler Lab
Gene Symbol Rps6ka2
Ensembl Gene ENSMUSG00000023809
Gene Nameribosomal protein S6 kinase, polypeptide 2
SynonymsRps6ka-rs1, pp90rsk, p90rsk, D17Wsu134e, 90kDa, Rsk3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.406) question?
Stock #R8353 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location7170115-7303315 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7246752 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 117 (N117D)
Ref Sequence ENSEMBL: ENSMUSP00000024575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024575] [ENSMUST00000232527]
Predicted Effect probably benign
Transcript: ENSMUST00000024575
AA Change: N117D

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000024575
Gene: ENSMUSG00000023809
AA Change: N117D

DomainStartEndE-ValueType
low complexity region 18 35 N/A INTRINSIC
S_TKc 59 318 6.25e-107 SMART
S_TK_X 319 380 3.36e-20 SMART
S_TKc 415 672 1.84e-104 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000232527
AA Change: N83D

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RSK (ribosomal S6 kinase) family of serine/threonine kinases. This kinase contains two non-identical kinase catalytic domains and phosphorylates various substrates, including members of the mitogen-activated kinase (MAPK) signalling pathway. The activity of this protein has been implicated in controlling cell growth and differentiation. Alternative splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased response of heart to stress following transverse aortic constriction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik A T 5: 90,566,501 R123S possibly damaging Het
8030462N17Rik T C 18: 77,673,908 E236G probably damaging Het
9630041A04Rik G T 9: 101,938,685 C23F possibly damaging Het
Adam29 T C 8: 55,873,161 H86R possibly damaging Het
Alas1 C T 9: 106,236,522 R508Q possibly damaging Het
Bmp3 G A 5: 98,855,423 probably null Het
Bud13 A G 9: 46,288,201 T287A probably benign Het
C3 T C 17: 57,212,643 E1203G probably benign Het
Carmil2 A C 8: 105,690,211 Q476P probably damaging Het
Ccdc187 T A 2: 26,276,446 T707S probably damaging Het
Cfap43 A T 19: 47,746,647 V1435E probably damaging Het
Chrm3 A T 13: 9,877,231 *590K probably null Het
Commd1 C T 11: 22,978,503 probably benign Het
Creb3l1 A T 2: 91,990,929 Y314* probably null Het
Ctc1 T A 11: 69,022,449 S90R probably benign Het
Dixdc1 T C 9: 50,684,886 Q413R probably benign Het
Dlg5 T C 14: 24,158,145 T998A probably benign Het
Fam89b A G 19: 5,728,875 S99P possibly damaging Het
Fbxo30 A G 10: 11,290,735 I400M probably benign Het
Gad1 A T 2: 70,600,713 M567L probably benign Het
Gemin5 T C 11: 58,125,239 S1314G probably benign Het
Gm2035 C T 12: 87,919,553 S102N probably benign Het
Gm9195 T G 14: 72,440,761 I2323L probably benign Het
Gria1 T A 11: 57,243,051 F585L probably damaging Het
Hbs1l A T 10: 21,309,279 H200L probably benign Het
Igsf5 A G 16: 96,421,796 Q360R probably benign Het
Il31ra A T 13: 112,524,183 V624E probably damaging Het
Iqsec3 T C 6: 121,387,820 R837G probably damaging Het
Lpl A G 8: 68,895,781 I221V probably damaging Het
Mink1 T A 11: 70,610,328 D887E possibly damaging Het
Mmp10 T G 9: 7,508,202 F443C probably damaging Het
Mmrn1 T A 6: 60,988,377 Y1131N probably damaging Het
Mrc2 T A 11: 105,332,311 V460E probably damaging Het
Nicn1 T A 9: 108,293,373 F57Y probably damaging Het
Nlrp4b A G 7: 10,715,601 Y577C probably damaging Het
Nrap T C 19: 56,323,920 T1535A probably damaging Het
Opa1 G A 16: 29,620,868 R755H probably damaging Het
Phldb2 A G 16: 45,825,022 S354P probably benign Het
Phykpl T C 11: 51,598,294 S316P probably damaging Het
Pnpla1 T A 17: 28,858,899 D11E probably benign Het
Pold2 A G 11: 5,875,104 F98L probably damaging Het
Prph G A 15: 99,056,776 R241Q probably benign Het
Rcl1 T C 19: 29,115,759 I58T possibly damaging Het
Sars G A 3: 108,428,713 S331L probably benign Het
Scfd1 A C 12: 51,412,591 K312Q possibly damaging Het
Senp5 A G 16: 31,989,348 C363R probably benign Het
Senp7 A G 16: 56,188,328 I1024V probably damaging Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sptbn4 A G 7: 27,404,238 L1191P probably damaging Het
Ssfa2 T C 2: 79,644,785 S363P probably benign Het
Stk40 A G 4: 126,128,973 E180G probably damaging Het
Stxbp5 A T 10: 9,809,048 V536E probably benign Het
Tex15 G T 8: 33,576,871 E2110* probably null Het
Thbs4 G A 13: 92,790,817 P55S probably benign Het
Tmem115 T C 9: 107,534,798 V107A probably benign Het
Tnfaip6 A C 2: 52,055,867 I242L probably benign Het
Trabd G T 15: 89,085,413 A270S possibly damaging Het
Trim30d T A 7: 104,487,740 I86F probably damaging Het
Trpc7 A G 13: 56,822,559 V404A probably benign Het
Vmn1r61 A G 7: 5,610,887 Y143H probably benign Het
Vmn2r18 T A 5: 151,561,908 D707V probably damaging Het
Vnn3 G A 10: 23,869,545 R464H probably benign Het
Wdr27 T C 17: 14,892,489 T652A probably benign Het
Wdr78 A G 4: 103,059,916 I577T possibly damaging Het
Yeats2 C T 16: 20,222,887 R1176* probably null Het
Other mutations in Rps6ka2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01782:Rps6ka2 APN 17 7236124 missense probably benign 0.02
IGL02199:Rps6ka2 APN 17 7254453 splice site probably benign
IGL02458:Rps6ka2 APN 17 7289003 missense probably benign 0.04
IGL02532:Rps6ka2 APN 17 7255966 missense probably damaging 1.00
IGL02741:Rps6ka2 APN 17 7296016 missense probably benign 0.22
IGL02860:Rps6ka2 APN 17 7282856 missense possibly damaging 0.68
IGL02948:Rps6ka2 APN 17 7254450 critical splice donor site probably null
IGL03037:Rps6ka2 APN 17 7254450 critical splice donor site probably null
IGL03085:Rps6ka2 APN 17 7295280 critical splice donor site probably null
IGL03302:Rps6ka2 APN 17 7299388 missense possibly damaging 0.83
IGL03303:Rps6ka2 APN 17 7228012 nonsense probably null
R0083:Rps6ka2 UTSW 17 7296043 missense probably benign 0.33
R0108:Rps6ka2 UTSW 17 7296043 missense probably benign 0.33
R0145:Rps6ka2 UTSW 17 7262186 missense probably benign 0.09
R0257:Rps6ka2 UTSW 17 7227983 missense probably damaging 1.00
R0355:Rps6ka2 UTSW 17 7271610 missense probably benign 0.03
R0563:Rps6ka2 UTSW 17 7254437 missense probably damaging 1.00
R1065:Rps6ka2 UTSW 17 7281758 splice site probably benign
R1465:Rps6ka2 UTSW 17 7292867 missense probably damaging 1.00
R1465:Rps6ka2 UTSW 17 7292867 missense probably damaging 1.00
R1540:Rps6ka2 UTSW 17 7292906 missense probably null 1.00
R1708:Rps6ka2 UTSW 17 7277530 missense probably damaging 0.99
R2418:Rps6ka2 UTSW 17 7299339 missense possibly damaging 0.76
R2697:Rps6ka2 UTSW 17 7300322 missense probably benign 0.07
R4427:Rps6ka2 UTSW 17 7299405 missense possibly damaging 0.90
R4753:Rps6ka2 UTSW 17 7299308 missense possibly damaging 0.86
R4951:Rps6ka2 UTSW 17 7292789 missense probably damaging 1.00
R4954:Rps6ka2 UTSW 17 7271604 missense probably benign 0.00
R4954:Rps6ka2 UTSW 17 7299286 missense probably benign
R6298:Rps6ka2 UTSW 17 7170367 missense possibly damaging 0.92
R6800:Rps6ka2 UTSW 17 7251636 missense probably damaging 1.00
R6905:Rps6ka2 UTSW 17 7227941 missense probably damaging 1.00
R6952:Rps6ka2 UTSW 17 7227978 missense probably benign 0.00
R7014:Rps6ka2 UTSW 17 7255932 missense probably benign 0.29
R7268:Rps6ka2 UTSW 17 7295263 missense possibly damaging 0.80
R7278:Rps6ka2 UTSW 17 7271635 missense probably damaging 1.00
R7476:Rps6ka2 UTSW 17 7271633 missense probably damaging 1.00
R7754:Rps6ka2 UTSW 17 7277449 splice site probably null
R8124:Rps6ka2 UTSW 17 7281829 missense possibly damaging 0.95
R8453:Rps6ka2 UTSW 17 7246752 missense probably benign 0.02
Z1177:Rps6ka2 UTSW 17 7290735 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCGGCCGTTATATTACC -3'
(R):5'- GTCTCTGGGATGAAGATAGGAC -3'

Sequencing Primer
(F):5'- ATATTACCTCAGATTTTCCCTGCGGG -3'
(R):5'- GATAGGACATCTTGCTCTTTTCAG -3'
Posted On2020-09-02