Incidental Mutation 'R8353:Wdr27'
ID 645652
Institutional Source Beutler Lab
Gene Symbol Wdr27
Ensembl Gene ENSMUSG00000046991
Gene Name WD repeat domain 27
Synonyms 0610012K18Rik
MMRRC Submission 067805-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.135) question?
Stock # R8353 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 15038781-15163420 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 15112751 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 652 (T652A)
Ref Sequence ENSEMBL: ENSMUSP00000126736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170386] [ENSMUST00000228330] [ENSMUST00000232147]
AlphaFold Q8C5V5
Predicted Effect probably benign
Transcript: ENSMUST00000170386
AA Change: T652A

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000126736
Gene: ENSMUSG00000046991
AA Change: T652A

DomainStartEndE-ValueType
WD40 59 99 4.79e-1 SMART
WD40 114 149 6.36e1 SMART
WD40 152 192 3.93e-7 SMART
WD40 195 235 2.38e1 SMART
low complexity region 473 492 N/A INTRINSIC
WD40 498 539 1.48e1 SMART
WD40 542 581 5.26e-8 SMART
WD40 642 684 2.97e0 SMART
WD40 687 737 7.64e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000228330
AA Change: T652A

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000232147
AA Change: T652A

PolyPhen 2 Score 0.313 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.2113 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with multiple WD repeats. Proteins with these repeats may form scaffolds for protein-protein interaction and play key roles in cell signalling. Alternative splicing results in multiple transcript variants, but the full-length structure of some of these variants cannot be determined. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9630041A04Rik G T 9: 101,815,884 (GRCm39) C23F possibly damaging Het
Adam29 T C 8: 56,326,196 (GRCm39) H86R possibly damaging Het
Alas1 C T 9: 106,113,721 (GRCm39) R508Q possibly damaging Het
Albfm1 A T 5: 90,714,360 (GRCm39) R123S possibly damaging Het
Ark2n T C 18: 77,761,604 (GRCm39) E236G probably damaging Het
Bmp3 G A 5: 99,003,282 (GRCm39) probably null Het
Bud13 A G 9: 46,199,499 (GRCm39) T287A probably benign Het
C3 T C 17: 57,519,643 (GRCm39) E1203G probably benign Het
Carmil2 A C 8: 106,416,843 (GRCm39) Q476P probably damaging Het
Ccdc187 T A 2: 26,166,458 (GRCm39) T707S probably damaging Het
Cfap43 A T 19: 47,735,086 (GRCm39) V1435E probably damaging Het
Chrm3 A T 13: 9,927,267 (GRCm39) *590K probably null Het
Commd1 C T 11: 22,928,503 (GRCm39) probably benign Het
Creb3l1 A T 2: 91,821,274 (GRCm39) Y314* probably null Het
Ctc1 T A 11: 68,913,275 (GRCm39) S90R probably benign Het
Dixdc1 T C 9: 50,596,186 (GRCm39) Q413R probably benign Het
Dlg5 T C 14: 24,208,213 (GRCm39) T998A probably benign Het
Dnai4 A G 4: 102,917,113 (GRCm39) I577T possibly damaging Het
Eif1ad14 C T 12: 87,886,323 (GRCm39) S102N probably benign Het
Fam89b A G 19: 5,778,903 (GRCm39) S99P possibly damaging Het
Fbxo30 A G 10: 11,166,479 (GRCm39) I400M probably benign Het
Gad1 A T 2: 70,431,057 (GRCm39) M567L probably benign Het
Gemin5 T C 11: 58,016,065 (GRCm39) S1314G probably benign Het
Gm9195 T G 14: 72,678,201 (GRCm39) I2323L probably benign Het
Gria1 T A 11: 57,133,877 (GRCm39) F585L probably damaging Het
Hbs1l A T 10: 21,185,178 (GRCm39) H200L probably benign Het
Igsf5 A G 16: 96,222,996 (GRCm39) Q360R probably benign Het
Il31ra A T 13: 112,660,717 (GRCm39) V624E probably damaging Het
Iqsec3 T C 6: 121,364,779 (GRCm39) R837G probably damaging Het
Itprid2 T C 2: 79,475,129 (GRCm39) S363P probably benign Het
Lpl A G 8: 69,348,433 (GRCm39) I221V probably damaging Het
Mink1 T A 11: 70,501,154 (GRCm39) D887E possibly damaging Het
Mmp10 T G 9: 7,508,203 (GRCm39) F443C probably damaging Het
Mmrn1 T A 6: 60,965,361 (GRCm39) Y1131N probably damaging Het
Mrc2 T A 11: 105,223,137 (GRCm39) V460E probably damaging Het
Nicn1 T A 9: 108,170,572 (GRCm39) F57Y probably damaging Het
Nlrp4b A G 7: 10,449,528 (GRCm39) Y577C probably damaging Het
Nrap T C 19: 56,312,352 (GRCm39) T1535A probably damaging Het
Opa1 G A 16: 29,439,686 (GRCm39) R755H probably damaging Het
Phldb2 A G 16: 45,645,385 (GRCm39) S354P probably benign Het
Phykpl T C 11: 51,489,121 (GRCm39) S316P probably damaging Het
Pnpla1 T A 17: 29,077,873 (GRCm39) D11E probably benign Het
Pold2 A G 11: 5,825,104 (GRCm39) F98L probably damaging Het
Prph G A 15: 98,954,657 (GRCm39) R241Q probably benign Het
Rcl1 T C 19: 29,093,159 (GRCm39) I58T possibly damaging Het
Rps6ka2 A G 17: 7,514,151 (GRCm39) N117D probably benign Het
Sars1 G A 3: 108,336,029 (GRCm39) S331L probably benign Het
Scfd1 A C 12: 51,459,374 (GRCm39) K312Q possibly damaging Het
Senp5 A G 16: 31,808,166 (GRCm39) C363R probably benign Het
Senp7 A G 16: 56,008,691 (GRCm39) I1024V probably damaging Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,066,742 (GRCm39) probably benign Het
Sptbn4 A G 7: 27,103,663 (GRCm39) L1191P probably damaging Het
Stk40 A G 4: 126,022,766 (GRCm39) E180G probably damaging Het
Stxbp5 A T 10: 9,684,792 (GRCm39) V536E probably benign Het
Tex15 G T 8: 34,066,899 (GRCm39) E2110* probably null Het
Thbs4 G A 13: 92,927,325 (GRCm39) P55S probably benign Het
Tmem115 T C 9: 107,411,997 (GRCm39) V107A probably benign Het
Tnfaip6 A C 2: 51,945,879 (GRCm39) I242L probably benign Het
Trabd G T 15: 88,969,616 (GRCm39) A270S possibly damaging Het
Trim30d T A 7: 104,136,947 (GRCm39) I86F probably damaging Het
Trpc7 A G 13: 56,970,372 (GRCm39) V404A probably benign Het
Vmn1r61 A G 7: 5,613,886 (GRCm39) Y143H probably benign Het
Vmn2r18 T A 5: 151,485,373 (GRCm39) D707V probably damaging Het
Vnn3 G A 10: 23,745,443 (GRCm39) R464H probably benign Het
Yeats2 C T 16: 20,041,637 (GRCm39) R1176* probably null Het
Other mutations in Wdr27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Wdr27 APN 17 15,148,572 (GRCm39) nonsense probably null
IGL00973:Wdr27 APN 17 15,134,140 (GRCm39) missense probably benign 0.01
IGL01012:Wdr27 APN 17 15,146,509 (GRCm39) missense probably damaging 1.00
IGL01924:Wdr27 APN 17 15,137,488 (GRCm39) missense probably damaging 0.99
IGL02044:Wdr27 APN 17 15,122,031 (GRCm39) missense possibly damaging 0.72
IGL02198:Wdr27 APN 17 15,128,860 (GRCm39) missense possibly damaging 0.52
IGL02430:Wdr27 APN 17 15,122,062 (GRCm39) missense probably damaging 0.98
IGL02496:Wdr27 APN 17 15,112,693 (GRCm39) splice site probably benign
IGL02552:Wdr27 APN 17 15,146,453 (GRCm39) missense probably damaging 1.00
IGL02590:Wdr27 APN 17 15,138,041 (GRCm39) missense possibly damaging 0.93
IGL02892:Wdr27 APN 17 15,096,438 (GRCm39) missense possibly damaging 0.95
IGL02957:Wdr27 APN 17 15,130,372 (GRCm39) splice site probably benign
IGL03295:Wdr27 APN 17 15,154,837 (GRCm39) missense possibly damaging 0.71
PIT4498001:Wdr27 UTSW 17 15,154,831 (GRCm39) missense probably benign 0.01
R0329:Wdr27 UTSW 17 15,154,721 (GRCm39) splice site probably benign
R0671:Wdr27 UTSW 17 15,148,658 (GRCm39) missense probably benign 0.04
R1166:Wdr27 UTSW 17 15,112,733 (GRCm39) missense probably damaging 1.00
R1308:Wdr27 UTSW 17 15,148,646 (GRCm39) missense probably damaging 0.98
R1652:Wdr27 UTSW 17 15,137,532 (GRCm39) missense probably benign 0.01
R1771:Wdr27 UTSW 17 15,112,703 (GRCm39) missense probably damaging 1.00
R1966:Wdr27 UTSW 17 15,154,861 (GRCm39) missense possibly damaging 0.86
R2106:Wdr27 UTSW 17 15,141,116 (GRCm39) missense probably benign 0.44
R2131:Wdr27 UTSW 17 15,148,594 (GRCm39) missense probably damaging 1.00
R3803:Wdr27 UTSW 17 15,138,371 (GRCm39) missense probably benign 0.01
R4335:Wdr27 UTSW 17 15,141,018 (GRCm39) splice site probably null
R4577:Wdr27 UTSW 17 15,123,724 (GRCm39) missense probably benign 0.00
R4787:Wdr27 UTSW 17 15,152,816 (GRCm39) missense possibly damaging 0.86
R4853:Wdr27 UTSW 17 15,137,475 (GRCm39) splice site probably null
R4922:Wdr27 UTSW 17 15,141,016 (GRCm39) splice site probably null
R4951:Wdr27 UTSW 17 15,096,395 (GRCm39) missense probably damaging 0.99
R5784:Wdr27 UTSW 17 15,146,495 (GRCm39) missense probably damaging 1.00
R5809:Wdr27 UTSW 17 15,103,931 (GRCm39) missense probably damaging 1.00
R6128:Wdr27 UTSW 17 15,152,796 (GRCm39) nonsense probably null
R6584:Wdr27 UTSW 17 15,122,031 (GRCm39) missense probably damaging 1.00
R6705:Wdr27 UTSW 17 15,154,852 (GRCm39) missense probably damaging 1.00
R7511:Wdr27 UTSW 17 15,103,965 (GRCm39) missense probably benign 0.00
R8273:Wdr27 UTSW 17 15,049,838 (GRCm39) missense probably benign
R8350:Wdr27 UTSW 17 15,152,787 (GRCm39) missense probably benign
R8450:Wdr27 UTSW 17 15,152,787 (GRCm39) missense probably benign
R8453:Wdr27 UTSW 17 15,112,751 (GRCm39) missense probably benign 0.08
R8535:Wdr27 UTSW 17 15,123,799 (GRCm39) missense possibly damaging 0.88
R8735:Wdr27 UTSW 17 15,103,929 (GRCm39) missense probably damaging 1.00
R8960:Wdr27 UTSW 17 15,103,908 (GRCm39) missense probably benign 0.01
R9120:Wdr27 UTSW 17 15,152,846 (GRCm39) missense probably damaging 1.00
R9183:Wdr27 UTSW 17 15,148,651 (GRCm39) missense possibly damaging 0.50
R9351:Wdr27 UTSW 17 15,128,833 (GRCm39) missense possibly damaging 0.52
R9373:Wdr27 UTSW 17 15,154,795 (GRCm39) missense probably benign 0.00
R9389:Wdr27 UTSW 17 15,111,980 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GAGAACCATTCATCCGACCTTTATGTC -3'
(R):5'- TTCCTGGCTGAAGATGACGG -3'

Sequencing Primer
(F):5'- TGTCCAGCATGACACCTCG -3'
(R):5'- GGCCTATCCCAGAAGCTATGTTG -3'
Posted On 2020-09-02