Incidental Mutation 'R8355:Rusc2'
ID645722
Institutional Source Beutler Lab
Gene Symbol Rusc2
Ensembl Gene ENSMUSG00000035969
Gene NameRUN and SH3 domain containing 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R8355 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location43381979-43427088 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43422846 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 994 (I994M)
Ref Sequence ENSEMBL: ENSMUSP00000095710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035645] [ENSMUST00000052829] [ENSMUST00000098106] [ENSMUST00000107928] [ENSMUST00000107929] [ENSMUST00000131668] [ENSMUST00000149221] [ENSMUST00000149676] [ENSMUST00000171134] [ENSMUST00000173682]
Predicted Effect probably benign
Transcript: ENSMUST00000035645
AA Change: I994M

PolyPhen 2 Score 0.351 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000038379
Gene: ENSMUSG00000035969
AA Change: I994M

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 600 617 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
RUN 1109 1177 3.66e-21 SMART
low complexity region 1235 1260 N/A INTRINSIC
low complexity region 1289 1324 N/A INTRINSIC
low complexity region 1330 1341 N/A INTRINSIC
SH3 1457 1512 7.4e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052829
SMART Domains Protein: ENSMUSP00000058980
Gene: ENSMUSG00000042788

DomainStartEndE-ValueType
Pfam:DUF2475 15 47 2.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098106
AA Change: I994M

PolyPhen 2 Score 0.351 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000095710
Gene: ENSMUSG00000035969
AA Change: I994M

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 600 617 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
RUN 1109 1177 3.66e-21 SMART
low complexity region 1235 1260 N/A INTRINSIC
low complexity region 1289 1324 N/A INTRINSIC
low complexity region 1330 1341 N/A INTRINSIC
SH3 1457 1512 7.4e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107928
SMART Domains Protein: ENSMUSP00000103561
Gene: ENSMUSG00000042788

DomainStartEndE-ValueType
Pfam:DUF2475 15 76 1.3e-20 PFAM
Pfam:DUF2475 212 251 6.9e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107929
SMART Domains Protein: ENSMUSP00000103562
Gene: ENSMUSG00000042788

DomainStartEndE-ValueType
Pfam:DUF2475 15 76 1.5e-20 PFAM
Pfam:DUF2475 232 271 7.7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131668
AA Change: I994M

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000118528
Gene: ENSMUSG00000035969
AA Change: I994M

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 600 617 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
RUN 1109 1177 3.66e-21 SMART
low complexity region 1235 1260 N/A INTRINSIC
low complexity region 1289 1324 N/A INTRINSIC
low complexity region 1330 1341 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149221
Predicted Effect probably benign
Transcript: ENSMUST00000149676
Predicted Effect probably benign
Transcript: ENSMUST00000155080
Predicted Effect probably benign
Transcript: ENSMUST00000171134
SMART Domains Protein: ENSMUSP00000127145
Gene: ENSMUSG00000042788

DomainStartEndE-ValueType
Pfam:DUF2475 15 76 7.2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173682
SMART Domains Protein: ENSMUSP00000133715
Gene: ENSMUSG00000035969

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 685 703 N/A INTRINSIC
low complexity region 733 740 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a RUN and SH3 domain containing protein that interacts with Rab1b and Rab1-binding protein GM130. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp A G 9: 104,326,975 V40A possibly damaging Het
Adgra1 T A 7: 139,875,651 C398* probably null Het
Amy2a1 T A 3: 113,530,396 D165V probably benign Het
Atf6b A G 17: 34,648,223 D63G probably benign Het
BC024139 T C 15: 76,119,807 D753G probably benign Het
Dnah3 T G 7: 119,952,208 T2963P probably damaging Het
Fanci G T 7: 79,435,281 L818F probably damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gm4559 C A 7: 142,273,957 C136F unknown Het
Gm45844 G A 7: 7,278,222 probably benign Het
Kmt2c T A 5: 25,354,501 probably null Het
Lpo G A 11: 87,814,288 L407F probably damaging Het
Mus81 T C 19: 5,484,192 Y366C probably damaging Het
Nipbl T C 15: 8,335,044 D1292G probably damaging Het
Nox3 A G 17: 3,685,923 S143P probably damaging Het
Npepps A T 11: 97,241,974 I309N probably damaging Het
Nufip2 C T 11: 77,692,433 T391I probably damaging Het
Olfr1002 T A 2: 85,648,141 Y60F probably damaging Het
Olfr873 A G 9: 20,300,419 Y74C probably damaging Het
Piezo2 A T 18: 63,090,998 V935E probably damaging Het
Sgcz T C 8: 37,723,085 I96V probably benign Het
Tmem108 A G 9: 103,499,870 S127P possibly damaging Het
Tmem178b G A 6: 40,254,935 V168I unknown Het
Tut1 T C 19: 8,959,262 V150A probably benign Het
Txnl4a T A 18: 80,207,324 L45Q probably damaging Het
V1ra8 C T 6: 90,203,465 R217W probably damaging Het
Vmn2r95 A G 17: 18,440,090 T255A probably benign Het
Zfp605 A G 5: 110,111,982 probably benign Het
Other mutations in Rusc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Rusc2 APN 4 43426116 missense probably damaging 0.97
IGL01474:Rusc2 APN 4 43416434 missense probably damaging 0.98
IGL01541:Rusc2 APN 4 43415840 missense probably benign 0.08
IGL01628:Rusc2 APN 4 43425729 missense probably damaging 1.00
IGL01969:Rusc2 APN 4 43415738 missense probably benign 0.02
IGL02030:Rusc2 APN 4 43416095 missense possibly damaging 0.86
IGL02079:Rusc2 APN 4 43425668 missense probably benign
IGL02115:Rusc2 APN 4 43426136 splice site probably benign
IGL02122:Rusc2 APN 4 43421685 missense possibly damaging 0.67
IGL02350:Rusc2 APN 4 43425351 missense possibly damaging 0.86
IGL02357:Rusc2 APN 4 43425351 missense possibly damaging 0.86
IGL02437:Rusc2 APN 4 43415545 missense probably damaging 1.00
IGL02930:Rusc2 APN 4 43416376 missense probably damaging 0.99
IGL03154:Rusc2 APN 4 43425806 missense probably benign 0.00
P0026:Rusc2 UTSW 4 43415840 missense possibly damaging 0.93
R0036:Rusc2 UTSW 4 43424009 missense probably damaging 1.00
R0068:Rusc2 UTSW 4 43424100 splice site probably benign
R0068:Rusc2 UTSW 4 43424100 splice site probably benign
R0114:Rusc2 UTSW 4 43422055 missense probably damaging 1.00
R0255:Rusc2 UTSW 4 43423954 missense probably damaging 1.00
R0471:Rusc2 UTSW 4 43425486 missense probably damaging 0.99
R1381:Rusc2 UTSW 4 43416137 missense probably damaging 1.00
R1413:Rusc2 UTSW 4 43416568 missense probably benign 0.00
R1416:Rusc2 UTSW 4 43421617 missense possibly damaging 0.86
R1731:Rusc2 UTSW 4 43426046 missense probably benign
R1864:Rusc2 UTSW 4 43421719 missense possibly damaging 0.49
R1897:Rusc2 UTSW 4 43421749 missense probably damaging 1.00
R2010:Rusc2 UTSW 4 43415212 missense probably benign 0.06
R2212:Rusc2 UTSW 4 43415935 missense probably damaging 1.00
R2275:Rusc2 UTSW 4 43416260 missense probably damaging 1.00
R2885:Rusc2 UTSW 4 43415456 missense probably benign 0.28
R2886:Rusc2 UTSW 4 43415456 missense probably benign 0.28
R3412:Rusc2 UTSW 4 43415935 missense probably damaging 1.00
R3413:Rusc2 UTSW 4 43415935 missense probably damaging 1.00
R3414:Rusc2 UTSW 4 43415935 missense probably damaging 1.00
R3852:Rusc2 UTSW 4 43416424 missense probably benign 0.45
R4135:Rusc2 UTSW 4 43425563 missense possibly damaging 0.49
R4272:Rusc2 UTSW 4 43415533 missense probably damaging 1.00
R4574:Rusc2 UTSW 4 43416080 missense probably damaging 0.99
R4888:Rusc2 UTSW 4 43423942 missense probably damaging 1.00
R5010:Rusc2 UTSW 4 43415926 missense probably damaging 1.00
R5071:Rusc2 UTSW 4 43415240 missense probably benign 0.05
R5131:Rusc2 UTSW 4 43414948 missense probably benign 0.03
R5177:Rusc2 UTSW 4 43421805 splice site probably null
R5540:Rusc2 UTSW 4 43423975 missense probably damaging 1.00
R5561:Rusc2 UTSW 4 43415932 nonsense probably null
R5628:Rusc2 UTSW 4 43425348 missense probably damaging 1.00
R5645:Rusc2 UTSW 4 43425758 missense probably benign 0.06
R6129:Rusc2 UTSW 4 43424271 missense probably damaging 1.00
R6362:Rusc2 UTSW 4 43416416 missense probably benign 0.30
R6633:Rusc2 UTSW 4 43414852 missense probably damaging 0.99
R6980:Rusc2 UTSW 4 43422846 missense probably benign 0.35
R7491:Rusc2 UTSW 4 43426528 missense probably damaging 1.00
R7641:Rusc2 UTSW 4 43425335 missense possibly damaging 0.84
R7698:Rusc2 UTSW 4 43414900 nonsense probably null
R7710:Rusc2 UTSW 4 43416119 missense probably benign 0.07
R8052:Rusc2 UTSW 4 43421851 missense probably benign
R8061:Rusc2 UTSW 4 43422492 missense probably damaging 1.00
R8127:Rusc2 UTSW 4 43423747 missense possibly damaging 0.54
R8319:Rusc2 UTSW 4 43425378 missense probably damaging 1.00
R8397:Rusc2 UTSW 4 43424206 missense possibly damaging 0.95
R8455:Rusc2 UTSW 4 43422846 missense probably benign 0.35
R8553:Rusc2 UTSW 4 43416508 missense probably benign 0.05
R8725:Rusc2 UTSW 4 43401351 intron probably benign
R8725:Rusc2 UTSW 4 43415396 missense probably damaging 0.99
R8727:Rusc2 UTSW 4 43401351 intron probably benign
X0025:Rusc2 UTSW 4 43422226 missense probably benign 0.00
X0066:Rusc2 UTSW 4 43422204 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGGTTGTACTCAGAGCAAGC -3'
(R):5'- TGATACGTGGCCCTCATTCAC -3'

Sequencing Primer
(F):5'- AGCTGAGAAGGGCCTGGC -3'
(R):5'- GTGGCCCTCATTCACTCAGAC -3'
Posted On2020-09-02