Incidental Mutation 'R8355:Nox3'
ID 645742
Institutional Source Beutler Lab
Gene Symbol Nox3
Ensembl Gene ENSMUSG00000023802
Gene Name NADPH oxidase 3
Synonyms nmf250, het
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock # R8355 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 3635240-3696261 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 3685923 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 143 (S143P)
Ref Sequence ENSEMBL: ENSMUSP00000111466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115800]
AlphaFold Q672J9
Predicted Effect probably damaging
Transcript: ENSMUST00000115800
AA Change: S143P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111466
Gene: ENSMUSG00000023802
AA Change: S143P

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Ferric_reduct 55 218 5.4e-23 PFAM
Pfam:FAD_binding_6 290 379 1.8e-8 PFAM
Pfam:FAD_binding_8 291 393 1.5e-27 PFAM
Pfam:NAD_binding_6 399 549 1e-34 PFAM
Meta Mutation Damage Score 0.4403 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the NOX family of NADPH oxidases. These enzymes catalyze the transfer of electrons from NADPH to molecular oxygen to produce superoxide and other reactive oxygen species (ROS). The ROS generated by family members have been implicated in numerous biological functions including host defense, posttranlational processing of proteins, cellular signaling, regulation of gene expression, and cell differentiation. The protein encoded by this gene is expressed predominantly in the inner ear and is involved in the biogenesis of otoconia, which are crystalline structures of the inner ear involved in the perception of gravity and linear acceleration. In mouse mutations of this gene lead to the absence of otoconia and vestibular dysfunction. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous mutants bilaterally lack otoliths in otherwise normal ears and display impaired swimming ability, motor capabilities, and vestibular responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp A G 9: 104,326,975 V40A possibly damaging Het
Adgra1 T A 7: 139,875,651 C398* probably null Het
Amy2a1 T A 3: 113,530,396 D165V probably benign Het
Atf6b A G 17: 34,648,223 D63G probably benign Het
BC024139 T C 15: 76,119,807 D753G probably benign Het
Dnah3 T G 7: 119,952,208 T2963P probably damaging Het
Fanci G T 7: 79,435,281 L818F probably damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gm4559 C A 7: 142,273,957 C136F unknown Het
Gm45844 G A 7: 7,278,222 probably benign Het
Kmt2c T A 5: 25,354,501 probably null Het
Lpo G A 11: 87,814,288 L407F probably damaging Het
Mus81 T C 19: 5,484,192 Y366C probably damaging Het
Nipbl T C 15: 8,335,044 D1292G probably damaging Het
Npepps A T 11: 97,241,974 I309N probably damaging Het
Nufip2 C T 11: 77,692,433 T391I probably damaging Het
Olfr1002 T A 2: 85,648,141 Y60F probably damaging Het
Olfr873 A G 9: 20,300,419 Y74C probably damaging Het
Piezo2 A T 18: 63,090,998 V935E probably damaging Het
Rusc2 A G 4: 43,422,846 I994M probably benign Het
Sgcz T C 8: 37,723,085 I96V probably benign Het
Tmem108 A G 9: 103,499,870 S127P possibly damaging Het
Tmem178b G A 6: 40,254,935 V168I unknown Het
Tut1 T C 19: 8,959,262 V150A probably benign Het
Txnl4a T A 18: 80,207,324 L45Q probably damaging Het
V1ra8 C T 6: 90,203,465 R217W probably damaging Het
Vmn2r95 A G 17: 18,440,090 T255A probably benign Het
Zfp605 A G 5: 110,111,982 probably benign Het
Other mutations in Nox3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Nox3 APN 17 3683015 missense probably damaging 0.99
IGL01135:Nox3 APN 17 3696252 utr 5 prime probably benign
IGL01791:Nox3 APN 17 3682943 missense possibly damaging 0.68
IGL02423:Nox3 APN 17 3682916 missense probably damaging 1.00
IGL03091:Nox3 APN 17 3665844 missense probably benign 0.42
R0046:Nox3 UTSW 17 3682961 missense probably benign 0.08
R0046:Nox3 UTSW 17 3682961 missense probably benign 0.08
R0085:Nox3 UTSW 17 3635281 missense probably benign 0.14
R0426:Nox3 UTSW 17 3695563 missense probably damaging 1.00
R0690:Nox3 UTSW 17 3695564 missense probably damaging 1.00
R1281:Nox3 UTSW 17 3696185 missense probably damaging 1.00
R1350:Nox3 UTSW 17 3650121 missense probably damaging 1.00
R1843:Nox3 UTSW 17 3669878 missense probably damaging 1.00
R1902:Nox3 UTSW 17 3670017 missense probably damaging 1.00
R2023:Nox3 UTSW 17 3694021 splice site probably benign
R2762:Nox3 UTSW 17 3696158 missense probably benign 0.35
R2872:Nox3 UTSW 17 3682916 missense probably damaging 1.00
R2872:Nox3 UTSW 17 3682916 missense probably damaging 1.00
R4429:Nox3 UTSW 17 3682958 missense probably benign 0.05
R4630:Nox3 UTSW 17 3693982 missense possibly damaging 0.53
R4926:Nox3 UTSW 17 3669894 missense probably damaging 1.00
R4928:Nox3 UTSW 17 3635275 missense probably null 1.00
R5181:Nox3 UTSW 17 3635286 nonsense probably null
R6911:Nox3 UTSW 17 3685923 missense probably damaging 1.00
R6912:Nox3 UTSW 17 3685923 missense probably damaging 1.00
R7486:Nox3 UTSW 17 3669944 missense probably damaging 1.00
R7529:Nox3 UTSW 17 3671775 missense probably damaging 0.99
R8357:Nox3 UTSW 17 3685923 missense probably damaging 1.00
R8455:Nox3 UTSW 17 3685923 missense probably damaging 1.00
R8457:Nox3 UTSW 17 3685923 missense probably damaging 1.00
R9028:Nox3 UTSW 17 3665910 missense possibly damaging 0.62
R9128:Nox3 UTSW 17 3669861 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGAAACCTCTTTTATCCAGC -3'
(R):5'- TTCAAGACACTGGGAGAGATGC -3'

Sequencing Primer
(F):5'- TTATCCAGCTCTTTTATGTGAAGC -3'
(R):5'- AATTCCTTGTAGACTGCCAGAGC -3'
Posted On 2020-09-02