Incidental Mutation 'R8356:Unc80'
ID 645750
Institutional Source Beutler Lab
Gene Symbol Unc80
Ensembl Gene ENSMUSG00000055567
Gene Name unc-80, NALCN activator
Synonyms C230061B10Rik, C030018G13Rik
MMRRC Submission 067870-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.891) question?
Stock # R8356 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 66507526-66738307 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 66680788 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 2128 (D2128G)
Ref Sequence ENSEMBL: ENSMUSP00000053692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061620] [ENSMUST00000212557]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000061620
AA Change: D2128G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000053692
Gene: ENSMUSG00000055567
AA Change: D2128G

DomainStartEndE-ValueType
Pfam:UNC80 16 236 2.2e-94 PFAM
low complexity region 372 385 N/A INTRINSIC
low complexity region 493 502 N/A INTRINSIC
low complexity region 693 711 N/A INTRINSIC
low complexity region 723 738 N/A INTRINSIC
low complexity region 739 769 N/A INTRINSIC
low complexity region 1038 1055 N/A INTRINSIC
low complexity region 1067 1084 N/A INTRINSIC
low complexity region 1309 1328 N/A INTRINSIC
low complexity region 1477 1489 N/A INTRINSIC
low complexity region 1676 1681 N/A INTRINSIC
low complexity region 1842 1848 N/A INTRINSIC
low complexity region 1854 1868 N/A INTRINSIC
low complexity region 2461 2480 N/A INTRINSIC
low complexity region 2726 2740 N/A INTRINSIC
low complexity region 3121 3144 N/A INTRINSIC
low complexity region 3245 3254 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000212557
AA Change: D2060G
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a voltage-independent 'leak' ion-channel complex, in which it performs essential functions, such as serving as a bridge between two other components (sodium leak channel non-selective and UNC79) and as a scaffold for Src kinases. Leak channels play an importnat role in establishment and maintenance of resting membrane potentials in neurons. Mutations in this gene are associated with congenital infantile encephalopathy, intellectual disability and growth issues. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A G 10: 79,842,360 (GRCm39) E1098G probably benign Het
Akap1 T A 11: 88,725,557 (GRCm39) probably null Het
Arhgap26 T C 18: 39,244,901 (GRCm39) V182A possibly damaging Het
Arhgef19 A G 4: 140,977,926 (GRCm39) K545R probably benign Het
Asph C T 4: 9,537,722 (GRCm39) R352Q probably benign Het
B3glct T A 5: 149,650,254 (GRCm39) I119N probably damaging Het
Bltp3b A G 10: 89,647,954 (GRCm39) T1339A probably benign Het
Camsap3 C T 8: 3,650,679 (GRCm39) R236* probably null Het
Ccser2 A T 14: 36,612,331 (GRCm39) M792K probably benign Het
Ceacam5 C T 7: 17,479,624 (GRCm39) T247I possibly damaging Het
Dnah9 A G 11: 66,047,764 (GRCm39) S19P probably damaging Het
Dtwd1 A G 2: 126,000,451 (GRCm39) E129G probably damaging Het
Ebf3 T A 7: 136,800,916 (GRCm39) M490L probably benign Het
Erbb4 A G 1: 68,110,789 (GRCm39) L1008S probably damaging Het
Ereg C T 5: 91,237,993 (GRCm39) P160S possibly damaging Het
Exoc6b ATTT ATTTT 6: 84,821,077 (GRCm39) probably null Het
Fmn1 A G 2: 113,195,385 (GRCm39) T362A unknown Het
Gm14326 A T 2: 177,590,312 (GRCm39) D16E probably benign Het
H1f8 A T 6: 115,925,745 (GRCm39) M181L probably benign Het
H3c1 A T 13: 23,946,083 (GRCm39) F85Y probably damaging Het
Herc6 A T 6: 57,575,548 (GRCm39) T190S probably benign Het
Lama1 T G 17: 68,044,491 (GRCm39) I130S Het
Letm2 T C 8: 26,071,729 (GRCm39) D391G probably damaging Het
Map3k9 T C 12: 81,780,892 (GRCm39) I423V probably damaging Het
Melk T A 4: 44,312,191 (GRCm39) C168S possibly damaging Het
Muc4 CAC CACTAC 16: 32,575,367 (GRCm39) probably benign Het
Naa16 A T 14: 79,596,915 (GRCm39) N356K probably benign Het
Nup214 A G 2: 31,929,372 (GRCm39) N1873S probably benign Het
Or2y1f C T 11: 49,184,385 (GRCm39) P79L probably damaging Het
Or8b41 T A 9: 38,054,981 (GRCm39) C178* probably null Het
Pom121 A G 5: 135,410,032 (GRCm39) F1042L unknown Het
Pramel51 T A 12: 88,143,986 (GRCm39) T284S probably benign Het
Pxdn T C 12: 30,061,889 (GRCm39) S1334P probably damaging Het
Ranbp1 C T 16: 18,063,170 (GRCm39) E69K probably damaging Het
Rasl11a T C 5: 146,782,045 (GRCm39) S7P probably damaging Het
Rev1 G A 1: 38,098,324 (GRCm39) R740* probably null Het
Rnf157 C T 11: 116,240,246 (GRCm39) V443M probably benign Het
Scn3a T A 2: 65,291,017 (GRCm39) T1910S probably benign Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,066,742 (GRCm39) probably benign Het
Siah2 T C 3: 58,583,503 (GRCm39) N261S probably benign Het
Sumf2 T G 5: 129,889,003 (GRCm39) W264G possibly damaging Het
Tal1 G T 4: 114,920,625 (GRCm39) A100S probably benign Het
Tox2 G T 2: 163,046,550 (GRCm39) R9L unknown Het
Traj46 A G 14: 54,409,795 (GRCm39) E1G Het
Usp21 A T 1: 171,112,290 (GRCm39) F308I probably damaging Het
Vgf A T 5: 137,061,265 (GRCm39) I476F probably damaging Het
Vmn1r142 T A 7: 21,862,748 (GRCm39) H238L probably benign Het
Vps35 G A 8: 85,987,934 (GRCm39) T739I possibly damaging Het
Wdr95 G T 5: 149,502,572 (GRCm39) C279F probably damaging Het
Zbtb32 T C 7: 30,289,381 (GRCm39) S94G unknown Het
Zdhhc13 T A 7: 48,452,747 (GRCm39) I153N probably damaging Het
Other mutations in Unc80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Unc80 APN 1 66,693,554 (GRCm39) missense possibly damaging 0.53
IGL00340:Unc80 APN 1 66,645,618 (GRCm39) missense possibly damaging 0.73
IGL00783:Unc80 APN 1 66,647,596 (GRCm39) missense probably benign 0.37
IGL00784:Unc80 APN 1 66,647,596 (GRCm39) missense probably benign 0.37
IGL00935:Unc80 APN 1 66,666,425 (GRCm39) missense possibly damaging 0.53
IGL01094:Unc80 APN 1 66,734,592 (GRCm39) missense possibly damaging 0.90
IGL01466:Unc80 APN 1 66,661,645 (GRCm39) missense probably benign 0.33
IGL01577:Unc80 APN 1 66,569,127 (GRCm39) splice site probably null
IGL01626:Unc80 APN 1 66,590,213 (GRCm39) critical splice donor site probably null
IGL01640:Unc80 APN 1 66,718,744 (GRCm39) missense probably benign 0.33
IGL01775:Unc80 APN 1 66,640,215 (GRCm39) missense possibly damaging 0.94
IGL01960:Unc80 APN 1 66,647,659 (GRCm39) splice site probably benign
IGL01991:Unc80 APN 1 66,508,668 (GRCm39) nonsense probably null
IGL02022:Unc80 APN 1 66,665,675 (GRCm39) missense possibly damaging 0.53
IGL02073:Unc80 APN 1 66,651,386 (GRCm39) missense possibly damaging 0.85
IGL02077:Unc80 APN 1 66,564,875 (GRCm39) missense possibly damaging 0.77
IGL02197:Unc80 APN 1 66,569,224 (GRCm39) missense probably benign 0.39
IGL02198:Unc80 APN 1 66,569,145 (GRCm39) missense possibly damaging 0.88
IGL02228:Unc80 APN 1 66,647,587 (GRCm39) missense possibly damaging 0.72
IGL02327:Unc80 APN 1 66,680,832 (GRCm39) missense probably benign 0.33
IGL02447:Unc80 APN 1 66,542,703 (GRCm39) missense possibly damaging 0.86
IGL02489:Unc80 APN 1 66,564,860 (GRCm39) missense probably benign 0.07
IGL02546:Unc80 APN 1 66,594,112 (GRCm39) missense possibly damaging 0.83
IGL02629:Unc80 APN 1 66,522,476 (GRCm39) missense possibly damaging 0.46
IGL02631:Unc80 APN 1 66,569,222 (GRCm39) missense probably damaging 0.98
IGL02839:Unc80 APN 1 66,710,834 (GRCm39) missense possibly damaging 0.53
IGL02960:Unc80 APN 1 66,717,217 (GRCm39) splice site probably benign
IGL02974:Unc80 APN 1 66,564,817 (GRCm39) missense possibly damaging 0.95
IGL03060:Unc80 APN 1 66,676,169 (GRCm39) missense possibly damaging 0.96
IGL03062:Unc80 APN 1 66,548,648 (GRCm39) missense probably damaging 0.96
IGL03074:Unc80 APN 1 66,710,877 (GRCm39) splice site probably benign
IGL03086:Unc80 APN 1 66,548,633 (GRCm39) missense probably damaging 0.99
IGL03105:Unc80 APN 1 66,511,258 (GRCm39) missense probably damaging 0.96
IGL03107:Unc80 APN 1 66,670,613 (GRCm39) missense probably damaging 0.98
IGL03158:Unc80 APN 1 66,680,833 (GRCm39) missense probably benign 0.33
IGL03220:Unc80 APN 1 66,544,097 (GRCm39) missense probably damaging 0.99
IGL03271:Unc80 APN 1 66,734,762 (GRCm39) unclassified probably benign
IGL03332:Unc80 APN 1 66,542,790 (GRCm39) missense probably damaging 1.00
IGL03347:Unc80 APN 1 66,734,625 (GRCm39) missense probably damaging 1.00
R0012:Unc80 UTSW 1 66,546,550 (GRCm39) missense probably damaging 1.00
R0012:Unc80 UTSW 1 66,546,550 (GRCm39) missense probably damaging 1.00
R0026:Unc80 UTSW 1 66,560,743 (GRCm39) missense probably benign 0.27
R0055:Unc80 UTSW 1 66,545,782 (GRCm39) splice site probably benign
R0149:Unc80 UTSW 1 66,560,760 (GRCm39) missense possibly damaging 0.82
R0325:Unc80 UTSW 1 66,550,040 (GRCm39) missense probably damaging 1.00
R0329:Unc80 UTSW 1 66,713,246 (GRCm39) missense possibly damaging 0.96
R0330:Unc80 UTSW 1 66,713,246 (GRCm39) missense possibly damaging 0.96
R0355:Unc80 UTSW 1 66,589,015 (GRCm39) missense possibly damaging 0.77
R0412:Unc80 UTSW 1 66,590,096 (GRCm39) splice site probably benign
R0422:Unc80 UTSW 1 66,522,497 (GRCm39) missense probably damaging 1.00
R0477:Unc80 UTSW 1 66,609,160 (GRCm39) missense probably damaging 0.99
R0507:Unc80 UTSW 1 66,567,052 (GRCm39) missense possibly damaging 0.66
R0513:Unc80 UTSW 1 66,661,633 (GRCm39) missense possibly damaging 0.73
R0553:Unc80 UTSW 1 66,545,828 (GRCm39) missense probably damaging 0.97
R0626:Unc80 UTSW 1 66,647,601 (GRCm39) missense probably benign 0.01
R0655:Unc80 UTSW 1 66,542,940 (GRCm39) missense probably damaging 0.98
R0742:Unc80 UTSW 1 66,567,052 (GRCm39) missense possibly damaging 0.66
R0755:Unc80 UTSW 1 66,544,082 (GRCm39) missense probably damaging 1.00
R0782:Unc80 UTSW 1 66,661,740 (GRCm39) missense possibly damaging 0.53
R0837:Unc80 UTSW 1 66,688,103 (GRCm39) missense possibly damaging 0.73
R0841:Unc80 UTSW 1 66,511,247 (GRCm39) missense probably damaging 1.00
R0893:Unc80 UTSW 1 66,560,645 (GRCm39) missense probably damaging 0.97
R0900:Unc80 UTSW 1 66,710,757 (GRCm39) missense probably benign 0.33
R0924:Unc80 UTSW 1 66,549,800 (GRCm39) missense possibly damaging 0.95
R0930:Unc80 UTSW 1 66,549,800 (GRCm39) missense possibly damaging 0.95
R0989:Unc80 UTSW 1 66,685,599 (GRCm39) missense possibly damaging 0.53
R1145:Unc80 UTSW 1 66,511,247 (GRCm39) missense probably damaging 1.00
R1145:Unc80 UTSW 1 66,511,247 (GRCm39) missense probably damaging 1.00
R1224:Unc80 UTSW 1 66,511,139 (GRCm39) missense probably damaging 1.00
R1240:Unc80 UTSW 1 66,675,061 (GRCm39) missense possibly damaging 0.85
R1245:Unc80 UTSW 1 66,594,254 (GRCm39) missense possibly damaging 0.94
R1467:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
R1473:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
R1500:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
R1556:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
R1562:Unc80 UTSW 1 66,677,116 (GRCm39) missense probably damaging 1.00
R1655:Unc80 UTSW 1 66,711,915 (GRCm39) missense possibly damaging 0.86
R1674:Unc80 UTSW 1 66,548,467 (GRCm39) missense probably damaging 1.00
R1680:Unc80 UTSW 1 66,542,828 (GRCm39) nonsense probably null
R1739:Unc80 UTSW 1 66,567,051 (GRCm39) missense probably damaging 0.97
R1756:Unc80 UTSW 1 66,678,407 (GRCm39) missense possibly damaging 0.53
R1783:Unc80 UTSW 1 66,722,432 (GRCm39) missense probably benign 0.01
R1834:Unc80 UTSW 1 66,678,407 (GRCm39) missense possibly damaging 0.53
R1854:Unc80 UTSW 1 66,670,573 (GRCm39) missense possibly damaging 0.93
R1871:Unc80 UTSW 1 66,549,876 (GRCm39) missense possibly damaging 0.77
R1878:Unc80 UTSW 1 66,548,561 (GRCm39) missense probably damaging 0.96
R1883:Unc80 UTSW 1 66,564,929 (GRCm39) missense possibly damaging 0.89
R1912:Unc80 UTSW 1 66,549,784 (GRCm39) missense probably damaging 1.00
R1990:Unc80 UTSW 1 66,731,708 (GRCm39) missense probably damaging 0.97
R2007:Unc80 UTSW 1 66,542,935 (GRCm39) missense probably damaging 1.00
R2035:Unc80 UTSW 1 66,645,752 (GRCm39) missense probably damaging 0.98
R2056:Unc80 UTSW 1 66,679,711 (GRCm39) missense possibly damaging 0.72
R2060:Unc80 UTSW 1 66,679,754 (GRCm39) missense possibly damaging 0.53
R2074:Unc80 UTSW 1 66,718,903 (GRCm39) critical splice donor site probably null
R2088:Unc80 UTSW 1 66,629,386 (GRCm39) missense possibly damaging 0.77
R2089:Unc80 UTSW 1 66,710,874 (GRCm39) splice site probably benign
R2091:Unc80 UTSW 1 66,710,874 (GRCm39) splice site probably benign
R2139:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
R2169:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
R2175:Unc80 UTSW 1 66,716,514 (GRCm39) missense probably damaging 1.00
R2248:Unc80 UTSW 1 66,662,365 (GRCm39) splice site probably benign
R2255:Unc80 UTSW 1 66,657,417 (GRCm39) missense possibly damaging 0.53
R2308:Unc80 UTSW 1 66,688,156 (GRCm39) missense possibly damaging 0.53
R2484:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
R2507:Unc80 UTSW 1 66,651,266 (GRCm39) missense possibly damaging 0.53
R2512:Unc80 UTSW 1 66,710,767 (GRCm39) missense possibly damaging 0.70
R2878:Unc80 UTSW 1 66,710,735 (GRCm39) critical splice acceptor site probably benign
R3040:Unc80 UTSW 1 66,678,464 (GRCm39) missense probably benign 0.33
R3104:Unc80 UTSW 1 66,662,450 (GRCm39) missense probably benign 0.33
R3402:Unc80 UTSW 1 66,549,845 (GRCm39) missense probably damaging 0.97
R3403:Unc80 UTSW 1 66,549,845 (GRCm39) missense probably damaging 0.97
R3413:Unc80 UTSW 1 66,678,464 (GRCm39) missense probably benign 0.33
R3426:Unc80 UTSW 1 66,678,464 (GRCm39) missense probably benign 0.33
R3427:Unc80 UTSW 1 66,678,464 (GRCm39) missense probably benign 0.33
R3428:Unc80 UTSW 1 66,678,464 (GRCm39) missense probably benign 0.33
R3904:Unc80 UTSW 1 66,678,455 (GRCm39) nonsense probably null
R3916:Unc80 UTSW 1 66,716,654 (GRCm39) missense probably benign 0.11
R3950:Unc80 UTSW 1 66,661,729 (GRCm39) missense possibly damaging 0.53
R4642:Unc80 UTSW 1 66,710,873 (GRCm39) splice site probably null
R4646:Unc80 UTSW 1 66,708,394 (GRCm39) missense probably benign 0.03
R4655:Unc80 UTSW 1 66,710,821 (GRCm39) missense probably benign 0.18
R4662:Unc80 UTSW 1 66,685,595 (GRCm39) missense probably benign 0.01
R4720:Unc80 UTSW 1 66,549,951 (GRCm39) missense possibly damaging 0.92
R4736:Unc80 UTSW 1 66,688,831 (GRCm39) critical splice acceptor site probably null
R4795:Unc80 UTSW 1 66,567,100 (GRCm39) missense probably damaging 0.97
R4888:Unc80 UTSW 1 66,683,606 (GRCm39) missense probably damaging 0.98
R4917:Unc80 UTSW 1 66,685,709 (GRCm39) missense possibly damaging 0.86
R4918:Unc80 UTSW 1 66,685,709 (GRCm39) missense possibly damaging 0.86
R4983:Unc80 UTSW 1 66,713,891 (GRCm39) splice site probably null
R5051:Unc80 UTSW 1 66,548,636 (GRCm39) missense probably damaging 0.96
R5111:Unc80 UTSW 1 66,567,154 (GRCm39) missense possibly damaging 0.66
R5122:Unc80 UTSW 1 66,718,749 (GRCm39) missense possibly damaging 0.53
R5260:Unc80 UTSW 1 66,685,746 (GRCm39) missense possibly damaging 0.53
R5351:Unc80 UTSW 1 66,645,672 (GRCm39) missense possibly damaging 0.73
R5387:Unc80 UTSW 1 66,569,180 (GRCm39) missense possibly damaging 0.77
R5437:Unc80 UTSW 1 66,693,737 (GRCm39) missense possibly damaging 0.96
R5525:Unc80 UTSW 1 66,645,773 (GRCm39) missense possibly damaging 0.72
R5621:Unc80 UTSW 1 66,677,202 (GRCm39) missense possibly damaging 0.53
R5690:Unc80 UTSW 1 66,679,731 (GRCm39) missense probably benign 0.08
R5762:Unc80 UTSW 1 66,732,955 (GRCm39) missense possibly damaging 0.82
R5956:Unc80 UTSW 1 66,567,123 (GRCm39) missense probably damaging 0.97
R6005:Unc80 UTSW 1 66,666,416 (GRCm39) missense possibly damaging 0.53
R6025:Unc80 UTSW 1 66,734,727 (GRCm39) missense possibly damaging 0.90
R6033:Unc80 UTSW 1 66,512,419 (GRCm39) missense possibly damaging 0.92
R6033:Unc80 UTSW 1 66,512,419 (GRCm39) missense possibly damaging 0.92
R6117:Unc80 UTSW 1 66,714,226 (GRCm39) missense possibly damaging 0.72
R6156:Unc80 UTSW 1 66,651,409 (GRCm39) missense probably benign 0.01
R6157:Unc80 UTSW 1 66,693,188 (GRCm39) nonsense probably null
R6189:Unc80 UTSW 1 66,716,630 (GRCm39) missense probably benign 0.33
R6291:Unc80 UTSW 1 66,560,756 (GRCm39) missense possibly damaging 0.82
R6367:Unc80 UTSW 1 66,711,925 (GRCm39) missense probably benign 0.33
R6598:Unc80 UTSW 1 66,507,699 (GRCm39) critical splice donor site probably null
R6724:Unc80 UTSW 1 66,722,350 (GRCm39) missense possibly damaging 0.90
R6763:Unc80 UTSW 1 66,560,636 (GRCm39) missense probably benign 0.00
R6773:Unc80 UTSW 1 66,690,702 (GRCm39) missense probably benign 0.33
R6883:Unc80 UTSW 1 66,685,563 (GRCm39) missense probably benign 0.33
R6951:Unc80 UTSW 1 66,687,670 (GRCm39) missense possibly damaging 0.53
R6965:Unc80 UTSW 1 66,685,725 (GRCm39) missense probably benign 0.33
R6993:Unc80 UTSW 1 66,588,952 (GRCm39) missense possibly damaging 0.60
R7041:Unc80 UTSW 1 66,542,752 (GRCm39) missense probably benign 0.00
R7050:Unc80 UTSW 1 66,590,067 (GRCm39) splice site probably null
R7067:Unc80 UTSW 1 66,685,731 (GRCm39) missense possibly damaging 0.86
R7080:Unc80 UTSW 1 66,685,680 (GRCm39) missense possibly damaging 0.53
R7193:Unc80 UTSW 1 66,588,943 (GRCm39) missense possibly damaging 0.60
R7197:Unc80 UTSW 1 66,560,725 (GRCm39) nonsense probably null
R7278:Unc80 UTSW 1 66,591,368 (GRCm39) missense possibly damaging 0.82
R7290:Unc80 UTSW 1 66,640,356 (GRCm39) missense probably damaging 0.97
R7391:Unc80 UTSW 1 66,734,687 (GRCm39) missense probably benign 0.18
R7401:Unc80 UTSW 1 66,685,574 (GRCm39) missense possibly damaging 0.96
R7470:Unc80 UTSW 1 66,661,621 (GRCm39) missense probably benign 0.02
R7573:Unc80 UTSW 1 66,560,696 (GRCm39) missense probably damaging 1.00
R7637:Unc80 UTSW 1 66,711,843 (GRCm39) missense possibly damaging 0.86
R7678:Unc80 UTSW 1 66,688,881 (GRCm39) missense probably benign 0.33
R7697:Unc80 UTSW 1 66,677,104 (GRCm39) missense possibly damaging 0.93
R7746:Unc80 UTSW 1 66,716,544 (GRCm39) missense probably benign 0.33
R7768:Unc80 UTSW 1 66,549,754 (GRCm39) missense possibly damaging 0.56
R7796:Unc80 UTSW 1 66,542,873 (GRCm39) missense probably benign
R7855:Unc80 UTSW 1 66,522,508 (GRCm39) missense possibly damaging 0.78
R7878:Unc80 UTSW 1 66,640,300 (GRCm39) missense possibly damaging 0.88
R7879:Unc80 UTSW 1 66,549,866 (GRCm39) missense probably benign 0.00
R8024:Unc80 UTSW 1 66,645,803 (GRCm39) missense possibly damaging 0.86
R8026:Unc80 UTSW 1 66,522,463 (GRCm39) missense possibly damaging 0.92
R8115:Unc80 UTSW 1 66,688,072 (GRCm39) missense probably benign 0.00
R8135:Unc80 UTSW 1 66,548,446 (GRCm39) missense possibly damaging 0.49
R8170:Unc80 UTSW 1 66,690,692 (GRCm39) missense probably benign 0.33
R8239:Unc80 UTSW 1 66,693,178 (GRCm39) missense probably benign
R8249:Unc80 UTSW 1 66,658,650 (GRCm39) missense probably benign 0.01
R8275:Unc80 UTSW 1 66,679,773 (GRCm39) nonsense probably null
R8288:Unc80 UTSW 1 66,512,509 (GRCm39) missense probably benign 0.07
R8341:Unc80 UTSW 1 66,688,192 (GRCm39) missense possibly damaging 0.73
R8433:Unc80 UTSW 1 66,677,187 (GRCm39) nonsense probably null
R8456:Unc80 UTSW 1 66,680,788 (GRCm39) missense possibly damaging 0.85
R8464:Unc80 UTSW 1 66,512,423 (GRCm39) missense probably damaging 1.00
R8483:Unc80 UTSW 1 66,732,869 (GRCm39) missense possibly damaging 0.83
R8509:Unc80 UTSW 1 66,680,788 (GRCm39) missense possibly damaging 0.85
R8686:Unc80 UTSW 1 66,651,427 (GRCm39) missense possibly damaging 0.53
R8701:Unc80 UTSW 1 66,677,191 (GRCm39) missense possibly damaging 0.85
R8729:Unc80 UTSW 1 66,647,649 (GRCm39) missense probably benign 0.01
R8755:Unc80 UTSW 1 66,651,290 (GRCm39) missense possibly damaging 0.53
R8771:Unc80 UTSW 1 66,685,554 (GRCm39) missense possibly damaging 0.85
R8866:Unc80 UTSW 1 66,629,388 (GRCm39) missense probably benign 0.05
R8877:Unc80 UTSW 1 66,567,144 (GRCm39) missense possibly damaging 0.89
R8942:Unc80 UTSW 1 66,512,468 (GRCm39) missense possibly damaging 0.94
R8976:Unc80 UTSW 1 66,511,169 (GRCm39) missense possibly damaging 0.87
R9063:Unc80 UTSW 1 66,645,816 (GRCm39) critical splice donor site probably null
R9095:Unc80 UTSW 1 66,545,912 (GRCm39) missense probably damaging 1.00
R9125:Unc80 UTSW 1 66,718,740 (GRCm39) missense probably benign 0.18
R9130:Unc80 UTSW 1 66,677,244 (GRCm39) missense possibly damaging 0.85
R9165:Unc80 UTSW 1 66,589,000 (GRCm39) missense probably null 0.95
R9220:Unc80 UTSW 1 66,546,534 (GRCm39) missense probably damaging 1.00
R9262:Unc80 UTSW 1 66,594,411 (GRCm39) intron probably benign
R9334:Unc80 UTSW 1 66,688,919 (GRCm39) missense possibly damaging 0.73
R9374:Unc80 UTSW 1 66,629,460 (GRCm39) missense possibly damaging 0.95
R9387:Unc80 UTSW 1 66,589,097 (GRCm39) critical splice donor site probably null
R9415:Unc80 UTSW 1 66,550,064 (GRCm39) missense
R9427:Unc80 UTSW 1 66,594,158 (GRCm39) missense probably damaging 1.00
R9436:Unc80 UTSW 1 66,732,964 (GRCm39) critical splice donor site probably null
R9454:Unc80 UTSW 1 66,734,749 (GRCm39) missense possibly damaging 0.53
R9522:Unc80 UTSW 1 66,677,221 (GRCm39) missense possibly damaging 0.73
R9539:Unc80 UTSW 1 66,609,163 (GRCm39) critical splice donor site probably null
R9552:Unc80 UTSW 1 66,717,282 (GRCm39) missense possibly damaging 0.85
R9667:Unc80 UTSW 1 66,651,287 (GRCm39) missense possibly damaging 0.86
R9720:Unc80 UTSW 1 66,683,485 (GRCm39) missense possibly damaging 0.53
R9749:Unc80 UTSW 1 66,544,179 (GRCm39) missense probably damaging 0.99
R9789:Unc80 UTSW 1 66,651,371 (GRCm39) missense possibly damaging 0.53
X0019:Unc80 UTSW 1 66,687,541 (GRCm39) missense probably benign 0.33
X0021:Unc80 UTSW 1 66,548,425 (GRCm39) critical splice acceptor site probably null
X0024:Unc80 UTSW 1 66,530,205 (GRCm39) missense probably benign 0.21
X0062:Unc80 UTSW 1 66,662,418 (GRCm39) missense probably benign 0.02
X0066:Unc80 UTSW 1 66,569,916 (GRCm39) missense possibly damaging 0.77
Y4335:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
Y4336:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
Y4338:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
Z1088:Unc80 UTSW 1 66,685,610 (GRCm39) missense possibly damaging 0.85
Z1176:Unc80 UTSW 1 66,733,568 (GRCm39) missense probably benign
Z1177:Unc80 UTSW 1 66,734,498 (GRCm39) missense probably benign 0.03
Z1177:Unc80 UTSW 1 66,685,557 (GRCm39) missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TGAAGCTTTCCTGAGGAGGG -3'
(R):5'- GGCACATTATTTTGAGCATGGC -3'

Sequencing Primer
(F):5'- CCTGAGGAGGGGGTTTTGC -3'
(R):5'- GTTTACAGATTACCTCCCC -3'
Posted On 2020-09-02