Mutagenetix > Incidental Mutation

Incidental Mutation 'R8356:Erbb4'

645751

Institutional Source

Beutler Lab

Gene Symbol

Erbb4

Ensembl Gene

ENSMUSG00000062209

Gene Name

erb-b2 receptor tyrosine kinase 4

Synonyms

Her4, ErbB4

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_010154.1; MGI:104771

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8356 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

68032186-69108059 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 68071630 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Serine at position 1008 (L1008S)

Ref Sequence

ENSEMBL: ENSMUSP00000114123 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119142] [ENSMUST00000121473]

AlphaFold

Q61527

Predicted Effect

probably damaging
Transcript: ENSMUST00000119142
AA Change: L1008S

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000112713
Gene: ENSMUSG00000062209
AA Change: L1008S

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Recep_L_domain	55	167	5e-34	PFAM
FU	183	223	2.07e1	SMART
FU	226	268	5.78e-10	SMART
Pfam:Recep_L_domain	358	478	1e-29	PFAM
FU	493	544	6.45e-8	SMART
FU	549	599	3.51e-9	SMART
FU	611	659	2.32e0	SMART
TyrKc	718	974	7.53e-133	SMART
low complexity region	1007	1023	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000121473
AA Change: L1008S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000114123
Gene: ENSMUSG00000062209
AA Change: L1008S

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Recep_L_domain	55	167	1.6e-34	PFAM
FU	183	223	2.07e1	SMART
FU	226	268	5.78e-10	SMART
Pfam:Recep_L_domain	358	478	5.5e-29	PFAM
FU	493	544	6.45e-8	SMART
FU	549	599	3.51e-9	SMART
FU	611	659	2.32e0	SMART
TyrKc	718	974	7.53e-133	SMART
low complexity region	1007	1023	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

MGI Phenotype

Strain: 1929607
Lethality: E10-E11
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Tyr protein kinase family and the epidermal growth factor receptor subfamily. It encodes a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain, a tyrosine kinase domain, a phosphotidylinositol-3 kinase binding site and a PDZ domain binding motif. The protein binds to and is activated by neuregulins and other factors and induces a variety of cellular responses including mitogenesis and differentiation. Multiple proteolytic events allow for the release of a cytoplasmic fragment and an extracellular fragment. Mutations in this gene have been associated with cancer. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit cardiac defects, alterations in hindbrain development, and midgestational lethality. Heterozygotes show schizophrenia-like behavior. Genetically rescued females show mammary defects. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted(6) Gene trapped(1)

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca7	A	G	10: 80,006,526	E1098G	probably benign	Het
Akap1	T	A	11: 88,834,731		probably null	Het
Arhgap26	T	C	18: 39,111,848	V182A	possibly damaging	Het
Arhgef19	A	G	4: 141,250,615	K545R	probably benign	Het
Asph	C	T	4: 9,537,722	R352Q	probably benign	Het
B3glct	T	A	5: 149,726,789	I119N	probably damaging	Het
Camsap3	C	T	8: 3,600,679	R236*	probably null	Het
Ccser2	A	T	14: 36,890,374	M792K	probably benign	Het
Ceacam5	C	T	7: 17,745,699	T247I	possibly damaging	Het
Dnah9	A	G	11: 66,156,938	S19P	probably damaging	Het
Dtwd1	A	G	2: 126,158,531	E129G	probably damaging	Het
Ebf3	T	A	7: 137,199,187	M490L	probably benign	Het
Ereg	C	T	5: 91,090,134	P160S	possibly damaging	Het
Exoc6b	ATTT	ATTTT	6: 84,844,095		probably null	Het
Fmn1	A	G	2: 113,365,040	T362A	unknown	Het
Gm10436	T	A	12: 88,177,216	T284S	probably benign	Het
Gm14326	A	T	2: 177,948,519	D16E	probably benign	Het
H1foo	A	T	6: 115,948,784	M181L	probably benign	Het
Herc6	A	T	6: 57,598,563	T190S	probably benign	Het
Hist1h3a	A	T	13: 23,762,100	F85Y	probably damaging	Het
Lama1	T	G	17: 67,737,496	I130S		Het
Letm2	T	C	8: 25,581,713	D391G	probably damaging	Het
Map3k9	T	C	12: 81,734,118	I423V	probably damaging	Het
Melk	T	A	4: 44,312,191	C168S	possibly damaging	Het
Muc4	CAC	CACTAC	16: 32,754,076		probably benign	Het
Naa16	A	T	14: 79,359,475	N356K	probably benign	Het
Nup214	A	G	2: 32,039,360	N1873S	probably benign	Het
Olfr1392	C	T	11: 49,293,558	P79L	probably damaging	Het
Olfr890	T	A	9: 38,143,685	C178*	probably null	Het
Pom121	A	G	5: 135,381,178	F1042L	unknown	Het
Pxdn	T	C	12: 30,011,890	S1334P	probably damaging	Het
Ranbp1	C	T	16: 18,245,306	E69K	probably damaging	Het
Rasl11a	T	C	5: 146,845,235	S7P	probably damaging	Het
Rev1	G	A	1: 38,059,243	R740*	probably null	Het
Rnf157	C	T	11: 116,349,420	V443M	probably benign	Het
Scn3a	T	A	2: 65,460,673	T1910S	probably benign	Het
Sh2b1	TGGGGACCAGCTCAGCCACGGGGACCAGCTC	TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC	7: 126,467,570		probably benign	Het
Siah2	T	C	3: 58,676,082	N261S	probably benign	Het
Sumf2	T	G	5: 129,860,162	W264G	possibly damaging	Het
Tal1	G	T	4: 115,063,428	A100S	probably benign	Het
Tox2	G	T	2: 163,204,630	R9L	unknown	Het
Traj46	A	G	14: 54,172,338	E1G		Het
Uhrf1bp1l	A	G	10: 89,812,092	T1339A	probably benign	Het
Unc80	A	G	1: 66,641,629	D2128G	possibly damaging	Het
Usp21	A	T	1: 171,284,717	F308I	probably damaging	Het
Vgf	A	T	5: 137,032,411	I476F	probably damaging	Het
Vmn1r142	T	A	7: 22,163,323	H238L	probably benign	Het
Vps35	G	A	8: 85,261,305	T739I	possibly damaging	Het
Wdr95	G	T	5: 149,579,107	C279F	probably damaging	Het
Zbtb32	T	C	7: 30,589,956	S94G	unknown	Het
Zdhhc13	T	A	7: 48,802,999	I153N	probably damaging	Het

Other mutations in Erbb4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00965:Erbb4	APN	1	68071630	nonsense	probably null
IGL01020:Erbb4	APN	1	68298449	splice site	probably benign
IGL01349:Erbb4	APN	1	68346593	missense	probably benign	0.00
IGL01386:Erbb4	APN	1	68343931	missense	probably damaging	1.00
IGL01516:Erbb4	APN	1	68328245	nonsense	probably null
IGL01536:Erbb4	APN	1	68290282	missense	probably benign	0.00
IGL01721:Erbb4	APN	1	68254563	missense	possibly damaging	0.46
IGL01832:Erbb4	APN	1	68254566	missense	possibly damaging	0.84
IGL02002:Erbb4	APN	1	68080726	missense	probably damaging	1.00
IGL02040:Erbb4	APN	1	68042535	missense	probably damaging	1.00
IGL02371:Erbb4	APN	1	68290294	missense	probably benign	0.00
IGL02399:Erbb4	APN	1	68042437	splice site	probably benign
IGL02553:Erbb4	APN	1	68305864	missense	probably benign	0.17
IGL03118:Erbb4	APN	1	68042719	missense	probably benign	0.11
IGL03329:Erbb4	APN	1	68328122	missense	probably benign	0.30
IGL03405:Erbb4	APN	1	68330238	missense	probably benign	0.02
earthworm	UTSW	1	68250580	missense	possibly damaging	0.67
excrescence	UTSW	1	68330246	missense	probably damaging	1.00
Mole	UTSW	1	68560576	missense	probably damaging	1.00
P0018:Erbb4	UTSW	1	68071676	missense	probably benign	0.05
PIT4480001:Erbb4	UTSW	1	68075543	missense	probably damaging	1.00
R0193:Erbb4	UTSW	1	68043960	intron	probably benign
R0329:Erbb4	UTSW	1	68298280	splice site	probably benign
R0335:Erbb4	UTSW	1	68259259	missense	probably benign
R0362:Erbb4	UTSW	1	68330270	missense	probably damaging	0.99
R0579:Erbb4	UTSW	1	68042462	missense	probably benign	0.17
R0730:Erbb4	UTSW	1	68259290	missense	probably damaging	0.98
R1029:Erbb4	UTSW	1	68309614	missense	probably damaging	0.96
R1444:Erbb4	UTSW	1	68254600	missense	probably damaging	1.00
R1469:Erbb4	UTSW	1	68560682	missense	probably damaging	0.99
R1469:Erbb4	UTSW	1	68560682	missense	probably damaging	0.99
R1503:Erbb4	UTSW	1	68346546	missense	probably benign	0.00
R1523:Erbb4	UTSW	1	68396252	missense	possibly damaging	0.95
R1528:Erbb4	UTSW	1	68078582	nonsense	probably null
R1604:Erbb4	UTSW	1	68346569	missense	possibly damaging	0.88
R1611:Erbb4	UTSW	1	68040388	missense	probably damaging	1.00
R1642:Erbb4	UTSW	1	68331234	missense	probably damaging	1.00
R1905:Erbb4	UTSW	1	68075410	splice site	probably benign
R1929:Erbb4	UTSW	1	68198888	missense	probably damaging	0.98
R2046:Erbb4	UTSW	1	68298323	missense	probably benign	0.02
R2139:Erbb4	UTSW	1	68346629	missense	probably damaging	0.96
R2271:Erbb4	UTSW	1	68198888	missense	probably damaging	0.98
R2298:Erbb4	UTSW	1	68042531	missense	probably damaging	1.00
R2356:Erbb4	UTSW	1	68078596	missense	probably benign	0.00
R3821:Erbb4	UTSW	1	68305913	missense	probably damaging	0.97
R4007:Erbb4	UTSW	1	68740401	missense	probably damaging	1.00
R4012:Erbb4	UTSW	1	68560576	missense	probably damaging	1.00
R4077:Erbb4	UTSW	1	68040337	missense	probably benign	0.07
R4196:Erbb4	UTSW	1	68343855	missense	possibly damaging	0.90
R4536:Erbb4	UTSW	1	68346622	missense	probably damaging	1.00
R4561:Erbb4	UTSW	1	68343921	nonsense	probably null
R4642:Erbb4	UTSW	1	68250632	missense	probably damaging	1.00
R4737:Erbb4	UTSW	1	68343900	missense	probably damaging	0.98
R4739:Erbb4	UTSW	1	68343900	missense	probably damaging	0.98
R4780:Erbb4	UTSW	1	68298314	missense	probably damaging	1.00
R4801:Erbb4	UTSW	1	68330246	missense	probably damaging	1.00
R4802:Erbb4	UTSW	1	68330246	missense	probably damaging	1.00
R4811:Erbb4	UTSW	1	68254544	missense	probably damaging	1.00
R4832:Erbb4	UTSW	1	68330238	missense	probably benign	0.02
R5068:Erbb4	UTSW	1	68043902	splice site	probably null
R5546:Erbb4	UTSW	1	68298293	missense	probably damaging	0.99
R5755:Erbb4	UTSW	1	68560519	missense	possibly damaging	0.96
R6189:Erbb4	UTSW	1	68043916	missense	probably benign
R6257:Erbb4	UTSW	1	68396273	missense	probably damaging	1.00
R6276:Erbb4	UTSW	1	68560576	missense	probably damaging	1.00
R6521:Erbb4	UTSW	1	68042530	missense	probably damaging	1.00
R6602:Erbb4	UTSW	1	68370503	missense	probably damaging	0.99
R6808:Erbb4	UTSW	1	68040303	missense	probably benign	0.00
R7087:Erbb4	UTSW	1	68740491	missense	probably null	1.00
R7215:Erbb4	UTSW	1	68339460	missense	probably benign
R7356:Erbb4	UTSW	1	68339355	critical splice donor site	probably null
R7509:Erbb4	UTSW	1	68250580	missense	possibly damaging	0.67
R7593:Erbb4	UTSW	1	68254599	missense	probably damaging	0.99
R7743:Erbb4	UTSW	1	68328119	missense	probably benign	0.00
R7784:Erbb4	UTSW	1	68075499	missense	probably damaging	1.00
R7815:Erbb4	UTSW	1	68042726	missense	probably damaging	1.00
R7923:Erbb4	UTSW	1	68259209	missense	probably damaging	1.00
R8071:Erbb4	UTSW	1	68396311	missense	probably damaging	1.00
R8288:Erbb4	UTSW	1	68298350	missense	probably damaging	1.00
R8456:Erbb4	UTSW	1	68071630	missense	probably damaging	1.00
R8464:Erbb4	UTSW	1	68309626	missense	probably benign
R8783:Erbb4	UTSW	1	68040172	missense	possibly damaging	0.95
R8830:Erbb4	UTSW	1	68075468	missense	probably damaging	1.00
R8881:Erbb4	UTSW	1	68343838	critical splice donor site	probably null
R9053:Erbb4	UTSW	1	68250620	missense	possibly damaging	0.63
R9142:Erbb4	UTSW	1	68349393	missense	probably damaging	1.00
R9237:Erbb4	UTSW	1	68042442	missense	possibly damaging	0.72
R9350:Erbb4	UTSW	1	68290479	missense	probably benign	0.00
R9374:Erbb4	UTSW	1	68740483	nonsense	probably null
R9434:Erbb4	UTSW	1	68042614	missense	possibly damaging	0.84
R9499:Erbb4	UTSW	1	68740483	nonsense	probably null
R9551:Erbb4	UTSW	1	68740483	nonsense	probably null
R9753:Erbb4	UTSW	1	68198903	missense	probably benign	0.00
X0019:Erbb4	UTSW	1	68073145	missense	probably benign	0.00
Z1176:Erbb4	UTSW	1	68328259	nonsense	probably null
Z1176:Erbb4	UTSW	1	68298402	frame shift	probably null
Z1177:Erbb4	UTSW	1	68290476	missense	probably damaging	1.00
Z1177:Erbb4	UTSW	1	68309643	missense	probably benign	0.06
Z1177:Erbb4	UTSW	1	68259183	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- AATGGTGATATCTCAGGGTACG -3'
(R):5'- ATGAGCACATGAATTCTCTAGCC -3'

Sequencing Primer
(F):5'- ATCTCAGGGTACGTATTGTATTGTC -3'
(R):5'- GCACATGAATTCTCTAGCCATTTGG -3'

Posted On

2020-09-02