Incidental Mutation 'R8356:Tox2'
ID645757
Institutional Source Beutler Lab
Gene Symbol Tox2
Ensembl Gene ENSMUSG00000074607
Gene NameTOX high mobility group box family member 2
SynonymsLOC269389, RxHMG1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8356 (G1)
Quality Score167.009
Status Not validated
Chromosome2
Chromosomal Location163203125-163324170 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 163204630 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 9 (R9L)
Ref Sequence ENSEMBL: ENSMUSP00000122344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109428] [ENSMUST00000128999]
Predicted Effect probably benign
Transcript: ENSMUST00000109428
SMART Domains Protein: ENSMUSP00000105055
Gene: ENSMUSG00000074607

DomainStartEndE-ValueType
low complexity region 68 80 N/A INTRINSIC
low complexity region 190 206 N/A INTRINSIC
HMG 245 315 1.44e-18 SMART
low complexity region 382 409 N/A INTRINSIC
low complexity region 415 429 N/A INTRINSIC
low complexity region 457 482 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000128999
AA Change: R9L
SMART Domains Protein: ENSMUSP00000122344
Gene: ENSMUSG00000074607
AA Change: R9L

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 46 57 N/A INTRINSIC
low complexity region 94 106 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A G 10: 80,006,526 E1098G probably benign Het
Akap1 T A 11: 88,834,731 probably null Het
Arhgap26 T C 18: 39,111,848 V182A possibly damaging Het
Arhgef19 A G 4: 141,250,615 K545R probably benign Het
Asph C T 4: 9,537,722 R352Q probably benign Het
B3glct T A 5: 149,726,789 I119N probably damaging Het
Camsap3 C T 8: 3,600,679 R236* probably null Het
Ccser2 A T 14: 36,890,374 M792K probably benign Het
Ceacam5 C T 7: 17,745,699 T247I possibly damaging Het
Dnah9 A G 11: 66,156,938 S19P probably damaging Het
Dtwd1 A G 2: 126,158,531 E129G probably damaging Het
Ebf3 T A 7: 137,199,187 M490L probably benign Het
Erbb4 A G 1: 68,071,630 L1008S probably damaging Het
Ereg C T 5: 91,090,134 P160S possibly damaging Het
Exoc6b ATTT ATTTT 6: 84,844,095 probably null Het
Fmn1 A G 2: 113,365,040 T362A unknown Het
Gm10436 T A 12: 88,177,216 T284S probably benign Het
Gm14326 A T 2: 177,948,519 D16E probably benign Het
H1foo A T 6: 115,948,784 M181L probably benign Het
Herc6 A T 6: 57,598,563 T190S probably benign Het
Hist1h3a A T 13: 23,762,100 F85Y probably damaging Het
Lama1 T G 17: 67,737,496 I130S Het
Letm2 T C 8: 25,581,713 D391G probably damaging Het
Map3k9 T C 12: 81,734,118 I423V probably damaging Het
Melk T A 4: 44,312,191 C168S possibly damaging Het
Muc4 CAC CACTAC 16: 32,754,076 probably benign Het
Naa16 A T 14: 79,359,475 N356K probably benign Het
Nup214 A G 2: 32,039,360 N1873S probably benign Het
Olfr1392 C T 11: 49,293,558 P79L probably damaging Het
Olfr890 T A 9: 38,143,685 C178* probably null Het
Pom121 A G 5: 135,381,178 F1042L unknown Het
Pxdn T C 12: 30,011,890 S1334P probably damaging Het
Ranbp1 C T 16: 18,245,306 E69K probably damaging Het
Rasl11a T C 5: 146,845,235 S7P probably damaging Het
Rev1 G A 1: 38,059,243 R740* probably null Het
Rnf157 C T 11: 116,349,420 V443M probably benign Het
Scn3a T A 2: 65,460,673 T1910S probably benign Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Siah2 T C 3: 58,676,082 N261S probably benign Het
Sumf2 T G 5: 129,860,162 W264G possibly damaging Het
Tal1 G T 4: 115,063,428 A100S probably benign Het
Traj46 A G 14: 54,172,338 E1G Het
Uhrf1bp1l A G 10: 89,812,092 T1339A probably benign Het
Unc80 A G 1: 66,641,629 D2128G possibly damaging Het
Usp21 A T 1: 171,284,717 F308I probably damaging Het
Vgf A T 5: 137,032,411 I476F probably damaging Het
Vmn1r142 T A 7: 22,163,323 H238L probably benign Het
Vps35 G A 8: 85,261,305 T739I possibly damaging Het
Wdr95 G T 5: 149,579,107 C279F probably damaging Het
Zbtb32 T C 7: 30,589,956 S94G unknown Het
Zdhhc13 T A 7: 48,802,999 I153N probably damaging Het
Other mutations in Tox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01444:Tox2 APN 2 163225466 utr 5 prime probably benign
IGL01891:Tox2 APN 2 163322983 missense possibly damaging 0.48
IGL02190:Tox2 APN 2 163323006 missense possibly damaging 0.91
IGL02576:Tox2 APN 2 163276180 missense probably damaging 0.99
R0881:Tox2 UTSW 2 163321445 missense probably benign 0.18
R1739:Tox2 UTSW 2 163247785 missense probably damaging 0.99
R1742:Tox2 UTSW 2 163225526 missense probably benign 0.04
R1900:Tox2 UTSW 2 163276167 missense probably damaging 1.00
R1937:Tox2 UTSW 2 163225556 missense probably benign
R2345:Tox2 UTSW 2 163319598 missense probably damaging 1.00
R2842:Tox2 UTSW 2 163204630 intron probably benign
R3753:Tox2 UTSW 2 163314323 missense probably damaging 1.00
R4614:Tox2 UTSW 2 163320647 missense probably damaging 1.00
R4615:Tox2 UTSW 2 163320647 missense probably damaging 1.00
R4616:Tox2 UTSW 2 163320647 missense probably damaging 1.00
R4618:Tox2 UTSW 2 163320647 missense probably damaging 1.00
R4625:Tox2 UTSW 2 163314416 missense possibly damaging 0.71
R5410:Tox2 UTSW 2 163320373 missense probably benign 0.04
R5493:Tox2 UTSW 2 163204729 nonsense probably null
R6731:Tox2 UTSW 2 163320377 missense probably damaging 1.00
R6965:Tox2 UTSW 2 163323010 makesense probably null
R7038:Tox2 UTSW 2 163314344 missense probably damaging 0.99
R7078:Tox2 UTSW 2 163320581 missense
R7422:Tox2 UTSW 2 163321515 missense
R7577:Tox2 UTSW 2 163315902 nonsense probably null
R7829:Tox2 UTSW 2 163320376 missense probably damaging 1.00
R8456:Tox2 UTSW 2 163204630 missense unknown
RF011:Tox2 UTSW 2 163225564 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AACTTAGTTCGGACGCCAG -3'
(R):5'- GCGCACAAAAGATAATCTGCTC -3'

Sequencing Primer
(F):5'- AGCCCGGATTGAACAGC -3'
(R):5'- CTGAGGATGCACTTGCA -3'
Posted On2020-09-02