Incidental Mutation 'R8356:Ebf3'
ID645779
Institutional Source Beutler Lab
Gene Symbol Ebf3
Ensembl Gene ENSMUSG00000010476
Gene Nameearly B cell factor 3
SynonymsOlf-1/EBF-like 2, O/E-2, 3110018A08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8356 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location137193673-137314445 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 137199187 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 490 (M490L)
Ref Sequence ENSEMBL: ENSMUSP00000147829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033378] [ENSMUST00000106118] [ENSMUST00000168203] [ENSMUST00000169486] [ENSMUST00000209578] [ENSMUST00000210774]
Predicted Effect probably benign
Transcript: ENSMUST00000033378
AA Change: M481L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000033378
Gene: ENSMUSG00000010476
AA Change: M481L

DomainStartEndE-ValueType
low complexity region 94 106 N/A INTRINSIC
IPT 253 337 2.09e-7 SMART
HLH 338 387 1.43e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106118
AA Change: M481L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000101724
Gene: ENSMUSG00000010476
AA Change: M481L

DomainStartEndE-ValueType
Pfam:COE1_DBD 17 247 2.6e-151 PFAM
IPT 262 346 2.09e-7 SMART
HLH 347 396 1.43e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168203
AA Change: M481L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000130334
Gene: ENSMUSG00000010476
AA Change: M481L

DomainStartEndE-ValueType
low complexity region 94 106 N/A INTRINSIC
IPT 253 337 2.09e-7 SMART
HLH 338 387 1.43e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169486
AA Change: M481L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000132563
Gene: ENSMUSG00000010476
AA Change: M481L

DomainStartEndE-ValueType
low complexity region 94 106 N/A INTRINSIC
IPT 253 337 2.09e-7 SMART
HLH 338 387 1.43e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209578
AA Change: M274L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000210774
AA Change: M490L

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the early B-cell factor (EBF) family of DNA binding transcription factors. EBF proteins are involved in B-cell differentiation, bone development and neurogenesis, and may also function as tumor suppressors. The encoded protein inhibits cell survival through the regulation of genes involved in cell cycle arrest and apoptosis, and aberrant methylation or deletion of this gene may play a role in multiple malignancies including glioblastoma multiforme and gastric carcinoma. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mutant mice die perinatally and exhibit impaired olfactory neuron projection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A G 10: 80,006,526 E1098G probably benign Het
Akap1 T A 11: 88,834,731 probably null Het
Arhgap26 T C 18: 39,111,848 V182A possibly damaging Het
Arhgef19 A G 4: 141,250,615 K545R probably benign Het
Asph C T 4: 9,537,722 R352Q probably benign Het
B3glct T A 5: 149,726,789 I119N probably damaging Het
Camsap3 C T 8: 3,600,679 R236* probably null Het
Ccser2 A T 14: 36,890,374 M792K probably benign Het
Ceacam5 C T 7: 17,745,699 T247I possibly damaging Het
Dnah9 A G 11: 66,156,938 S19P probably damaging Het
Dtwd1 A G 2: 126,158,531 E129G probably damaging Het
Erbb4 A G 1: 68,071,630 L1008S probably damaging Het
Ereg C T 5: 91,090,134 P160S possibly damaging Het
Exoc6b ATTT ATTTT 6: 84,844,095 probably null Het
Fmn1 A G 2: 113,365,040 T362A unknown Het
Gm10436 T A 12: 88,177,216 T284S probably benign Het
Gm14326 A T 2: 177,948,519 D16E probably benign Het
H1foo A T 6: 115,948,784 M181L probably benign Het
Herc6 A T 6: 57,598,563 T190S probably benign Het
Hist1h3a A T 13: 23,762,100 F85Y probably damaging Het
Lama1 T G 17: 67,737,496 I130S Het
Letm2 T C 8: 25,581,713 D391G probably damaging Het
Map3k9 T C 12: 81,734,118 I423V probably damaging Het
Melk T A 4: 44,312,191 C168S possibly damaging Het
Muc4 CAC CACTAC 16: 32,754,076 probably benign Het
Naa16 A T 14: 79,359,475 N356K probably benign Het
Nup214 A G 2: 32,039,360 N1873S probably benign Het
Olfr1392 C T 11: 49,293,558 P79L probably damaging Het
Olfr890 T A 9: 38,143,685 C178* probably null Het
Pom121 A G 5: 135,381,178 F1042L unknown Het
Pxdn T C 12: 30,011,890 S1334P probably damaging Het
Ranbp1 C T 16: 18,245,306 E69K probably damaging Het
Rasl11a T C 5: 146,845,235 S7P probably damaging Het
Rev1 G A 1: 38,059,243 R740* probably null Het
Rnf157 C T 11: 116,349,420 V443M probably benign Het
Scn3a T A 2: 65,460,673 T1910S probably benign Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Siah2 T C 3: 58,676,082 N261S probably benign Het
Sumf2 T G 5: 129,860,162 W264G possibly damaging Het
Tal1 G T 4: 115,063,428 A100S probably benign Het
Tox2 G T 2: 163,204,630 R9L unknown Het
Traj46 A G 14: 54,172,338 E1G Het
Uhrf1bp1l A G 10: 89,812,092 T1339A probably benign Het
Unc80 A G 1: 66,641,629 D2128G possibly damaging Het
Usp21 A T 1: 171,284,717 F308I probably damaging Het
Vgf A T 5: 137,032,411 I476F probably damaging Het
Vmn1r142 T A 7: 22,163,323 H238L probably benign Het
Vps35 G A 8: 85,261,305 T739I possibly damaging Het
Wdr95 G T 5: 149,579,107 C279F probably damaging Het
Zbtb32 T C 7: 30,589,956 S94G unknown Het
Zdhhc13 T A 7: 48,802,999 I153N probably damaging Het
Other mutations in Ebf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Ebf3 APN 7 137225896 splice site probably benign
IGL01938:Ebf3 APN 7 137309318 missense probably damaging 1.00
IGL02076:Ebf3 APN 7 137231301 missense possibly damaging 0.61
IGL02260:Ebf3 APN 7 137206190 missense probably damaging 1.00
IGL02303:Ebf3 APN 7 137309365 missense probably benign 0.01
IGL02828:Ebf3 APN 7 137307518 missense probably damaging 0.98
IGL03211:Ebf3 APN 7 137231304 missense probably benign 0.21
R0885:Ebf3 UTSW 7 137225884 missense probably benign 0.10
R0962:Ebf3 UTSW 7 137225203 missense probably damaging 0.99
R1166:Ebf3 UTSW 7 137313167 splice site probably benign
R1255:Ebf3 UTSW 7 137225212 missense probably benign 0.35
R1804:Ebf3 UTSW 7 137200521 missense possibly damaging 0.89
R4298:Ebf3 UTSW 7 137225229 missense possibly damaging 0.95
R4393:Ebf3 UTSW 7 137225157 missense probably damaging 0.99
R5061:Ebf3 UTSW 7 137313559 missense possibly damaging 0.57
R5880:Ebf3 UTSW 7 137198638 missense probably benign 0.04
R6024:Ebf3 UTSW 7 137200535 missense probably damaging 1.00
R6109:Ebf3 UTSW 7 137206226 missense probably damaging 1.00
R6634:Ebf3 UTSW 7 137201160 missense probably damaging 0.99
R6958:Ebf3 UTSW 7 137199265 missense possibly damaging 0.66
R6997:Ebf3 UTSW 7 137225265 missense probably damaging 0.97
R7578:Ebf3 UTSW 7 137313532 missense probably damaging 1.00
R7771:Ebf3 UTSW 7 137309363 missense probably damaging 1.00
R8133:Ebf3 UTSW 7 137313143 missense probably damaging 1.00
R8185:Ebf3 UTSW 7 137225878 missense possibly damaging 0.87
R8456:Ebf3 UTSW 7 137199187 missense probably benign 0.41
R8520:Ebf3 UTSW 7 137201124 critical splice donor site probably null
RF022:Ebf3 UTSW 7 137313942 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TATCCAGTAGCTCACATCACAG -3'
(R):5'- TCCAAGCTGGCTAGAGTCAC -3'

Sequencing Primer
(F):5'- GTAGCTCACATCACAGAACATCCAAG -3'
(R):5'- GGGGAATTTTAACAGTCGG -3'
Posted On2020-09-02