Incidental Mutation 'R8357:Epb41l1'
ID645807
Institutional Source Beutler Lab
Gene Symbol Epb41l1
Ensembl Gene ENSMUSG00000027624
Gene Nameerythrocyte membrane protein band 4.1 like 1
SynonymsEpb4.1l1, 4.1N
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8357 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location156420909-156543214 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 156525251 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 680 (R680Q)
Ref Sequence ENSEMBL: ENSMUSP00000099426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029155] [ENSMUST00000103136] [ENSMUST00000103137] [ENSMUST00000109574] [ENSMUST00000109577] [ENSMUST00000125153]
Predicted Effect probably benign
Transcript: ENSMUST00000029155
AA Change: R680Q

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000029155
Gene: ENSMUSG00000027624
AA Change: R680Q

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 459 472 N/A INTRINSIC
Pfam:SAB 493 544 8.4e-25 PFAM
low complexity region 606 615 N/A INTRINSIC
Pfam:4_1_CTD 770 867 5.9e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103136
AA Change: R680Q

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000099425
Gene: ENSMUSG00000027624
AA Change: R680Q

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 459 472 N/A INTRINSIC
Pfam:SAB 493 544 8.4e-25 PFAM
low complexity region 606 615 N/A INTRINSIC
Pfam:4_1_CTD 770 867 5.9e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103137
AA Change: R680Q

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000099426
Gene: ENSMUSG00000027624
AA Change: R680Q

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 459 472 N/A INTRINSIC
Pfam:SAB 493 544 5.9e-25 PFAM
low complexity region 606 615 N/A INTRINSIC
Pfam:4_1_CTD 740 866 1.6e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109574
SMART Domains Protein: ENSMUSP00000105202
Gene: ENSMUSG00000027624

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 458 471 N/A INTRINSIC
Pfam:SAB 480 531 4.8e-24 PFAM
Pfam:4_1_CTD 610 718 4.9e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109577
AA Change: R668Q

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105205
Gene: ENSMUSG00000027624
AA Change: R668Q

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 459 472 N/A INTRINSIC
Pfam:SAB 481 532 5.9e-24 PFAM
low complexity region 594 603 N/A INTRINSIC
Pfam:4_1_CTD 758 855 5.8e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125153
SMART Domains Protein: ENSMUSP00000121161
Gene: ENSMUSG00000027624

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 458 471 N/A INTRINSIC
Pfam:SAB 492 543 7.4e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Erythrocyte membrane protein band 4.1 (EPB41) is a multifunctional protein that mediates interactions between the erythrocyte cytoskeleton and the overlying plasma membrane. The encoded protein binds and stabilizes D2 and D3 dopamine receptors at the neuronal plasma membrane. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit no obvious phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T A 11: 46,140,112 L813Q probably damaging Het
Alpk3 A G 7: 81,093,318 N961S probably damaging Het
Arhgap42 A T 9: 9,016,220 S403T probably benign Het
Cdkl1 T C 12: 69,747,338 T342A probably benign Het
Chd2 T C 7: 73,447,237 E1497G probably damaging Het
Cldn11 T C 3: 31,163,193 V170A probably benign Het
Cps1 T A 1: 67,156,854 F291I probably damaging Het
Cpsf2 T A 12: 102,002,670 S722T probably damaging Het
Creld1 T C 6: 113,491,738 probably null Het
Dgki T A 6: 36,850,956 E1002V possibly damaging Het
Disp3 T A 4: 148,261,115 I423F possibly damaging Het
Dysf T C 6: 84,188,245 V1601A probably benign Het
E4f1 G A 17: 24,446,527 A347V probably benign Het
Ehmt2 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 17: 34,905,161 probably benign Het
Fcrl5 T G 3: 87,444,260 S272A probably damaging Het
Gbp7 A T 3: 142,546,372 D572V probably benign Het
Gm21903 A T 17: 39,043,320 F8I unknown Het
Grin2b A G 6: 135,732,199 S1450P probably benign Het
Icos C A 1: 60,993,856 S71R probably damaging Het
Ighv1-13 T A 12: 114,630,832 N51K unknown Het
Ighv1-37 C T 12: 114,896,625 probably benign Het
Il1f9 A G 2: 24,188,649 Y87C probably benign Het
Irf7 T C 7: 141,263,281 N440D possibly damaging Het
Ivns1abp T A 1: 151,354,010 L150M probably damaging Het
Kif16b A G 2: 142,711,908 I990T probably damaging Het
Kif23 A G 9: 61,927,035 probably null Het
Lca5l T G 16: 96,159,708 K523T possibly damaging Het
Mast3 A G 8: 70,780,441 F1076L probably benign Het
Nek11 A T 9: 105,347,992 I107N probably damaging Het
Nlrp12 T C 7: 3,240,805 H359R probably damaging Het
Nox3 A G 17: 3,685,923 S143P probably damaging Het
Olfr1495 A T 19: 13,768,357 N5I probably benign Het
Olfr957 A C 9: 39,511,146 N191K probably benign Het
Rnf10 C A 5: 115,272,261 K51N possibly damaging Het
Scap G A 9: 110,381,286 G921D probably benign Het
Tk2 A T 8: 104,236,818 S140T probably damaging Het
Tmem106b A G 6: 13,084,244 Y249C probably damaging Het
Ttll5 T A 12: 85,876,578 S276R probably damaging Het
Ugt1a7c T C 1: 88,095,356 V79A probably benign Het
Zfp410 T C 12: 84,327,312 V141A possibly damaging Het
Other mutations in Epb41l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Epb41l1 APN 2 156525019 missense probably damaging 1.00
IGL00852:Epb41l1 APN 2 156503718 missense probably damaging 1.00
IGL02148:Epb41l1 APN 2 156511828 intron probably benign
IGL02164:Epb41l1 APN 2 156494949 splice site probably benign
IGL02515:Epb41l1 APN 2 156537013 missense probably damaging 1.00
R0787:Epb41l1 UTSW 2 156494090 missense probably damaging 0.98
R1450:Epb41l1 UTSW 2 156511825 intron probably benign
R1566:Epb41l1 UTSW 2 156521959 missense probably benign 0.06
R1759:Epb41l1 UTSW 2 156521974 missense probably benign 0.06
R1812:Epb41l1 UTSW 2 156496511 missense probably damaging 1.00
R1908:Epb41l1 UTSW 2 156510817 missense possibly damaging 0.80
R2152:Epb41l1 UTSW 2 156514128 missense probably damaging 1.00
R3023:Epb41l1 UTSW 2 156514209 missense probably damaging 0.99
R4178:Epb41l1 UTSW 2 156521557 missense probably benign
R4491:Epb41l1 UTSW 2 156522168 missense probably benign 0.00
R4610:Epb41l1 UTSW 2 156509261 missense possibly damaging 0.71
R4770:Epb41l1 UTSW 2 156529424 missense probably benign 0.00
R5038:Epb41l1 UTSW 2 156521410 missense probably benign 0.12
R5049:Epb41l1 UTSW 2 156524939 missense possibly damaging 0.95
R5129:Epb41l1 UTSW 2 156509281 missense possibly damaging 0.80
R5624:Epb41l1 UTSW 2 156533771 splice site probably benign
R5780:Epb41l1 UTSW 2 156496525 missense probably damaging 1.00
R5810:Epb41l1 UTSW 2 156499655 missense probably damaging 1.00
R5952:Epb41l1 UTSW 2 156503788 missense probably damaging 1.00
R5952:Epb41l1 UTSW 2 156524983 missense probably benign
R5961:Epb41l1 UTSW 2 156521786 missense probably benign 0.25
R6118:Epb41l1 UTSW 2 156522477 missense probably benign 0.13
R6496:Epb41l1 UTSW 2 156533796 missense possibly damaging 0.92
R6861:Epb41l1 UTSW 2 156525222 missense probably benign
R6959:Epb41l1 UTSW 2 156499587 missense probably benign 0.03
R7009:Epb41l1 UTSW 2 156534683 splice site probably null
R7036:Epb41l1 UTSW 2 156529402 missense probably benign
R7046:Epb41l1 UTSW 2 156526892 missense possibly damaging 0.56
R7263:Epb41l1 UTSW 2 156495123 critical splice donor site probably null
R7322:Epb41l1 UTSW 2 156503851 missense probably damaging 0.98
R7398:Epb41l1 UTSW 2 156534762 missense probably damaging 1.00
R7914:Epb41l1 UTSW 2 156522208 missense probably benign 0.03
R8039:Epb41l1 UTSW 2 156506412 missense probably damaging 0.99
R8415:Epb41l1 UTSW 2 156526953 missense probably benign 0.00
R8457:Epb41l1 UTSW 2 156525251 missense probably benign 0.16
R8458:Epb41l1 UTSW 2 156521764 missense probably benign 0.00
X0065:Epb41l1 UTSW 2 156509277 missense probably damaging 1.00
Z1177:Epb41l1 UTSW 2 156508827 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ATTACGGTCAGCTCCACGTC -3'
(R):5'- ACATGCGTTGCAGAACCATG -3'

Sequencing Primer
(F):5'- AGGCTGAGGTGGACTTCAC -3'
(R):5'- AACCATGCTGTTCTACGAGG -3'
Posted On2020-09-02