Mutagenetix > Incidental Mutation

Incidental Mutation 'R8357:Disp3'

645811

Institutional Source

Beutler Lab

Gene Symbol

Disp3

Ensembl Gene

ENSMUSG00000041544

Gene Name

dispatched RND transporter family member 3

Synonyms

Ptchd2, G630052C06Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8357 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

148240264-148287965 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 148261115 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 423 (I423F)

Ref Sequence

ENSEMBL: ENSMUSP00000038490 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047720]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000047720
AA Change: I423F

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000038490
Gene: ENSMUSG00000041544
AA Change: I423F

Domain	Start	End	E-Value	Type
transmembrane domain	68	90	N/A	INTRINSIC
low complexity region	159	171	N/A	INTRINSIC
low complexity region	179	195	N/A	INTRINSIC
Pfam:Patched	362	735	2.2e-21	PFAM
Pfam:MMPL	366	590	3.1e-14	PFAM
Pfam:Sterol-sensing	435	588	1.1e-17	PFAM
Pfam:Patched	1121	1301	1.6e-7	PFAM
transmembrane domain	1314	1333	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam19	T	A	11: 46,140,112	L813Q	probably damaging	Het
Alpk3	A	G	7: 81,093,318	N961S	probably damaging	Het
Arhgap42	A	T	9: 9,016,220	S403T	probably benign	Het
Cdkl1	T	C	12: 69,747,338	T342A	probably benign	Het
Chd2	T	C	7: 73,447,237	E1497G	probably damaging	Het
Cldn11	T	C	3: 31,163,193	V170A	probably benign	Het
Cps1	T	A	1: 67,156,854	F291I	probably damaging	Het
Cpsf2	T	A	12: 102,002,670	S722T	probably damaging	Het
Creld1	T	C	6: 113,491,738		probably null	Het
Dgki	T	A	6: 36,850,956	E1002V	possibly damaging	Het
Dysf	T	C	6: 84,188,245	V1601A	probably benign	Het
E4f1	G	A	17: 24,446,527	A347V	probably benign	Het
Ehmt2	TGAGGAGGAGGAGGAGGA	TGAGGAGGAGGAGGA	17: 34,905,161		probably benign	Het
Epb41l1	G	A	2: 156,525,251	R680Q	probably benign	Het
Fcrl5	T	G	3: 87,444,260	S272A	probably damaging	Het
Gbp7	A	T	3: 142,546,372	D572V	probably benign	Het
Gm21903	A	T	17: 39,043,320	F8I	unknown	Het
Grin2b	A	G	6: 135,732,199	S1450P	probably benign	Het
Icos	C	A	1: 60,993,856	S71R	probably damaging	Het
Ighv1-13	T	A	12: 114,630,832	N51K	unknown	Het
Ighv1-37	C	T	12: 114,896,625		probably benign	Het
Il1f9	A	G	2: 24,188,649	Y87C	probably benign	Het
Irf7	T	C	7: 141,263,281	N440D	possibly damaging	Het
Ivns1abp	T	A	1: 151,354,010	L150M	probably damaging	Het
Kif16b	A	G	2: 142,711,908	I990T	probably damaging	Het
Kif23	A	G	9: 61,927,035		probably null	Het
Lca5l	T	G	16: 96,159,708	K523T	possibly damaging	Het
Mast3	A	G	8: 70,780,441	F1076L	probably benign	Het
Nek11	A	T	9: 105,347,992	I107N	probably damaging	Het
Nlrp12	T	C	7: 3,240,805	H359R	probably damaging	Het
Nox3	A	G	17: 3,685,923	S143P	probably damaging	Het
Olfr1495	A	T	19: 13,768,357	N5I	probably benign	Het
Olfr957	A	C	9: 39,511,146	N191K	probably benign	Het
Rnf10	C	A	5: 115,272,261	K51N	possibly damaging	Het
Scap	G	A	9: 110,381,286	G921D	probably benign	Het
Tk2	A	T	8: 104,236,818	S140T	probably damaging	Het
Tmem106b	A	G	6: 13,084,244	Y249C	probably damaging	Het
Ttll5	T	A	12: 85,876,578	S276R	probably damaging	Het
Ugt1a7c	T	C	1: 88,095,356	V79A	probably benign	Het
Zfp410	T	C	12: 84,327,312	V141A	possibly damaging	Het

Other mutations in Disp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Disp3	APN	4	148241534	missense	probably benign	0.10
IGL01065:Disp3	APN	4	148261183	missense	probably damaging	1.00
IGL01800:Disp3	APN	4	148249801	nonsense	probably null
IGL01947:Disp3	APN	4	148260519	missense	probably damaging	1.00
IGL02510:Disp3	APN	4	148252701	missense	probably benign	0.00
IGL02573:Disp3	APN	4	148271449	missense	probably damaging	1.00
IGL02728:Disp3	APN	4	148272038	missense	probably damaging	1.00
IGL02931:Disp3	APN	4	148249201	missense	possibly damaging	0.94
R0164:Disp3	UTSW	4	148254251	missense	probably damaging	0.96
R0164:Disp3	UTSW	4	148254251	missense	probably damaging	0.96
R0257:Disp3	UTSW	4	148250754	missense	possibly damaging	0.87
R0409:Disp3	UTSW	4	148271959	missense	probably damaging	1.00
R0557:Disp3	UTSW	4	148241404	missense	possibly damaging	0.64
R0576:Disp3	UTSW	4	148241590	missense	possibly damaging	0.89
R1495:Disp3	UTSW	4	148249825	missense	probably benign	0.00
R1526:Disp3	UTSW	4	148259916	missense	probably benign	0.00
R1791:Disp3	UTSW	4	148241518	missense	probably damaging	1.00
R1856:Disp3	UTSW	4	148271632	missense	probably damaging	1.00
R1987:Disp3	UTSW	4	148258753	missense	probably damaging	0.97
R2030:Disp3	UTSW	4	148259966	missense	probably damaging	1.00
R2271:Disp3	UTSW	4	148271602	missense	possibly damaging	0.87
R2373:Disp3	UTSW	4	148258795	missense	probably damaging	1.00
R2566:Disp3	UTSW	4	148241423	missense	probably damaging	1.00
R3731:Disp3	UTSW	4	148252827	missense	probably benign	0.03
R4359:Disp3	UTSW	4	148271932	missense	probably benign	0.03
R4762:Disp3	UTSW	4	148272118	missense	probably damaging	1.00
R4950:Disp3	UTSW	4	148258126	missense	possibly damaging	0.94
R4975:Disp3	UTSW	4	148244216	missense	possibly damaging	0.79
R5218:Disp3	UTSW	4	148242876	missense	possibly damaging	0.88
R5523:Disp3	UTSW	4	148258097	missense	probably benign	0.14
R5556:Disp3	UTSW	4	148258157	missense	probably benign	0.14
R5857:Disp3	UTSW	4	148249183	missense	probably benign	0.01
R5933:Disp3	UTSW	4	148241313	nonsense	probably null
R5994:Disp3	UTSW	4	148254284	missense	possibly damaging	0.94
R6362:Disp3	UTSW	4	148254308	missense	possibly damaging	0.95
R6813:Disp3	UTSW	4	148259930	missense	probably benign	0.09
R7211:Disp3	UTSW	4	148241522	missense	probably damaging	0.98
R7470:Disp3	UTSW	4	148261070	missense	possibly damaging	0.88
R7535:Disp3	UTSW	4	148242866	missense	probably damaging	0.99
R8093:Disp3	UTSW	4	148270516	missense	possibly damaging	0.93
R8457:Disp3	UTSW	4	148261115	missense	possibly damaging	0.86
R8506:Disp3	UTSW	4	148241570	missense	possibly damaging	0.77
R9182:Disp3	UTSW	4	148270384	missense	probably damaging	1.00
R9219:Disp3	UTSW	4	148249860	missense	possibly damaging	0.74
R9680:Disp3	UTSW	4	148271644	missense	probably damaging	1.00
R9696:Disp3	UTSW	4	148261154	missense	probably damaging	0.97
Z1088:Disp3	UTSW	4	148271743	missense	possibly damaging	0.63
Z1176:Disp3	UTSW	4	148250957	missense	probably damaging	1.00
Z1177:Disp3	UTSW	4	148249746	missense	probably damaging	1.00
Z1177:Disp3	UTSW	4	148249847	missense	probably benign	0.01
Z1177:Disp3	UTSW	4	148250714	missense	probably damaging	1.00
Z1177:Disp3	UTSW	4	148270567	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CATTTGGCCCAGCTCTAAGG -3'
(R):5'- GGCTGATTGTCGCTGATTACTATC -3'

Sequencing Primer
(F):5'- TCTAAGGAACCAGATTCAGGGCTATC -3'
(R):5'- TACACGTTGAATCACCTGGG -3'

Posted On

2020-09-02