Incidental Mutation 'R8357:Lca5l'
ID645836
Institutional Source Beutler Lab
Gene Symbol Lca5l
Ensembl Gene ENSMUSG00000045275
Gene NameLeber congenital amaurosis 5-like
Synonyms4921526F01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R8357 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location96158407-96192257 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 96159708 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 523 (K523T)
Ref Sequence ENSEMBL: ENSMUSP00000061337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023913] [ENSMUST00000054855] [ENSMUST00000113804]
Predicted Effect probably benign
Transcript: ENSMUST00000023913
SMART Domains Protein: ENSMUSP00000023913
Gene: ENSMUSG00000023147

DomainStartEndE-ValueType
Pfam:CHD5 12 163 1.4e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000054855
AA Change: K523T

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000061337
Gene: ENSMUSG00000045275
AA Change: K523T

DomainStartEndE-ValueType
low complexity region 39 53 N/A INTRINSIC
Pfam:Lebercilin 144 336 5.6e-68 PFAM
low complexity region 528 544 N/A INTRINSIC
low complexity region 654 670 N/A INTRINSIC
low complexity region 679 688 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113804
AA Change: K518T

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109435
Gene: ENSMUSG00000045275
AA Change: K518T

DomainStartEndE-ValueType
low complexity region 34 48 N/A INTRINSIC
Pfam:Lebercilin 138 331 1.9e-71 PFAM
low complexity region 523 539 N/A INTRINSIC
low complexity region 649 665 N/A INTRINSIC
low complexity region 674 683 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T A 11: 46,140,112 L813Q probably damaging Het
Alpk3 A G 7: 81,093,318 N961S probably damaging Het
Arhgap42 A T 9: 9,016,220 S403T probably benign Het
Cdkl1 T C 12: 69,747,338 T342A probably benign Het
Chd2 T C 7: 73,447,237 E1497G probably damaging Het
Cldn11 T C 3: 31,163,193 V170A probably benign Het
Cps1 T A 1: 67,156,854 F291I probably damaging Het
Cpsf2 T A 12: 102,002,670 S722T probably damaging Het
Creld1 T C 6: 113,491,738 probably null Het
Dgki T A 6: 36,850,956 E1002V possibly damaging Het
Disp3 T A 4: 148,261,115 I423F possibly damaging Het
Dysf T C 6: 84,188,245 V1601A probably benign Het
E4f1 G A 17: 24,446,527 A347V probably benign Het
Ehmt2 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 17: 34,905,161 probably benign Het
Epb41l1 G A 2: 156,525,251 R680Q probably benign Het
Fcrl5 T G 3: 87,444,260 S272A probably damaging Het
Gbp7 A T 3: 142,546,372 D572V probably benign Het
Gm21903 A T 17: 39,043,320 F8I unknown Het
Grin2b A G 6: 135,732,199 S1450P probably benign Het
Icos C A 1: 60,993,856 S71R probably damaging Het
Ighv1-13 T A 12: 114,630,832 N51K unknown Het
Ighv1-37 C T 12: 114,896,625 probably benign Het
Il1f9 A G 2: 24,188,649 Y87C probably benign Het
Irf7 T C 7: 141,263,281 N440D possibly damaging Het
Ivns1abp T A 1: 151,354,010 L150M probably damaging Het
Kif16b A G 2: 142,711,908 I990T probably damaging Het
Kif23 A G 9: 61,927,035 probably null Het
Mast3 A G 8: 70,780,441 F1076L probably benign Het
Nek11 A T 9: 105,347,992 I107N probably damaging Het
Nlrp12 T C 7: 3,240,805 H359R probably damaging Het
Nox3 A G 17: 3,685,923 S143P probably damaging Het
Olfr1495 A T 19: 13,768,357 N5I probably benign Het
Olfr957 A C 9: 39,511,146 N191K probably benign Het
Rnf10 C A 5: 115,272,261 K51N possibly damaging Het
Scap G A 9: 110,381,286 G921D probably benign Het
Tk2 A T 8: 104,236,818 S140T probably damaging Het
Tmem106b A G 6: 13,084,244 Y249C probably damaging Het
Ttll5 T A 12: 85,876,578 S276R probably damaging Het
Ugt1a7c T C 1: 88,095,356 V79A probably benign Het
Zfp410 T C 12: 84,327,312 V141A possibly damaging Het
Other mutations in Lca5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00667:Lca5l APN 16 96161412 missense possibly damaging 0.90
IGL02893:Lca5l APN 16 96178913 missense probably benign 0.01
IGL03056:Lca5l APN 16 96161351 missense probably benign 0.26
IGL03208:Lca5l APN 16 96178846 missense probably damaging 0.98
IGL03267:Lca5l APN 16 96159783 missense probably benign 0.03
R0417:Lca5l UTSW 16 96162653 missense probably damaging 1.00
R0961:Lca5l UTSW 16 96161360 missense possibly damaging 0.90
R1458:Lca5l UTSW 16 96159859 missense possibly damaging 0.95
R1650:Lca5l UTSW 16 96178940 critical splice acceptor site probably null
R1669:Lca5l UTSW 16 96159808 missense possibly damaging 0.95
R1706:Lca5l UTSW 16 96175964 missense probably benign 0.41
R2004:Lca5l UTSW 16 96162649 missense probably damaging 1.00
R2004:Lca5l UTSW 16 96176018 missense possibly damaging 0.95
R4291:Lca5l UTSW 16 96178774 missense probably damaging 1.00
R4307:Lca5l UTSW 16 96159556 unclassified probably benign
R4824:Lca5l UTSW 16 96162029 nonsense probably null
R4920:Lca5l UTSW 16 96178835 missense probably damaging 1.00
R4991:Lca5l UTSW 16 96159732 missense possibly damaging 0.90
R5591:Lca5l UTSW 16 96178729 missense probably damaging 1.00
R5774:Lca5l UTSW 16 96176061 missense probably benign 0.22
R6243:Lca5l UTSW 16 96178912 missense possibly damaging 0.90
R6403:Lca5l UTSW 16 96173845 missense probably benign 0.41
R7153:Lca5l UTSW 16 96173809 missense probably damaging 0.98
R7754:Lca5l UTSW 16 96159561 missense unknown
R7758:Lca5l UTSW 16 96178837 missense probably benign 0.00
R7814:Lca5l UTSW 16 96162557 critical splice donor site probably null
R8401:Lca5l UTSW 16 96162560 missense probably damaging 0.99
R8457:Lca5l UTSW 16 96159708 missense possibly damaging 0.95
RF031:Lca5l UTSW 16 96159304 frame shift probably null
RF042:Lca5l UTSW 16 96159297 frame shift probably null
RF050:Lca5l UTSW 16 96159301 small deletion probably benign
RF059:Lca5l UTSW 16 96159301 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TCTTTCTGTCGCGGAATGCC -3'
(R):5'- CTCAAAGCTCCATCTTTCTAAAGC -3'

Sequencing Primer
(F):5'- AAGGAGTAGTGCTTCCGCG -3'
(R):5'- CAGATTTATCAAAGGAGGTCGAACAC -3'
Posted On2020-09-02