Incidental Mutation 'R8357:Nox3'
ID 645837
Institutional Source Beutler Lab
Gene Symbol Nox3
Ensembl Gene ENSMUSG00000023802
Gene Name NADPH oxidase 3
Synonyms nmf250, het
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock # R8357 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 3635240-3696261 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 3685923 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 143 (S143P)
Ref Sequence ENSEMBL: ENSMUSP00000111466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115800]
AlphaFold Q672J9
Predicted Effect probably damaging
Transcript: ENSMUST00000115800
AA Change: S143P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111466
Gene: ENSMUSG00000023802
AA Change: S143P

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Ferric_reduct 55 218 5.4e-23 PFAM
Pfam:FAD_binding_6 290 379 1.8e-8 PFAM
Pfam:FAD_binding_8 291 393 1.5e-27 PFAM
Pfam:NAD_binding_6 399 549 1e-34 PFAM
Meta Mutation Damage Score 0.4403 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the NOX family of NADPH oxidases. These enzymes catalyze the transfer of electrons from NADPH to molecular oxygen to produce superoxide and other reactive oxygen species (ROS). The ROS generated by family members have been implicated in numerous biological functions including host defense, posttranlational processing of proteins, cellular signaling, regulation of gene expression, and cell differentiation. The protein encoded by this gene is expressed predominantly in the inner ear and is involved in the biogenesis of otoconia, which are crystalline structures of the inner ear involved in the perception of gravity and linear acceleration. In mouse mutations of this gene lead to the absence of otoconia and vestibular dysfunction. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous mutants bilaterally lack otoliths in otherwise normal ears and display impaired swimming ability, motor capabilities, and vestibular responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T A 11: 46,140,112 L813Q probably damaging Het
Alpk3 A G 7: 81,093,318 N961S probably damaging Het
Arhgap42 A T 9: 9,016,220 S403T probably benign Het
Cdkl1 T C 12: 69,747,338 T342A probably benign Het
Chd2 T C 7: 73,447,237 E1497G probably damaging Het
Cldn11 T C 3: 31,163,193 V170A probably benign Het
Cps1 T A 1: 67,156,854 F291I probably damaging Het
Cpsf2 T A 12: 102,002,670 S722T probably damaging Het
Creld1 T C 6: 113,491,738 probably null Het
Dgki T A 6: 36,850,956 E1002V possibly damaging Het
Disp3 T A 4: 148,261,115 I423F possibly damaging Het
Dysf T C 6: 84,188,245 V1601A probably benign Het
E4f1 G A 17: 24,446,527 A347V probably benign Het
Ehmt2 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 17: 34,905,161 probably benign Het
Epb41l1 G A 2: 156,525,251 R680Q probably benign Het
Fcrl5 T G 3: 87,444,260 S272A probably damaging Het
Gbp7 A T 3: 142,546,372 D572V probably benign Het
Gm21903 A T 17: 39,043,320 F8I unknown Het
Grin2b A G 6: 135,732,199 S1450P probably benign Het
Icos C A 1: 60,993,856 S71R probably damaging Het
Ighv1-13 T A 12: 114,630,832 N51K unknown Het
Ighv1-37 C T 12: 114,896,625 probably benign Het
Il1f9 A G 2: 24,188,649 Y87C probably benign Het
Irf7 T C 7: 141,263,281 N440D possibly damaging Het
Ivns1abp T A 1: 151,354,010 L150M probably damaging Het
Kif16b A G 2: 142,711,908 I990T probably damaging Het
Kif23 A G 9: 61,927,035 probably null Het
Lca5l T G 16: 96,159,708 K523T possibly damaging Het
Mast3 A G 8: 70,780,441 F1076L probably benign Het
Nek11 A T 9: 105,347,992 I107N probably damaging Het
Nlrp12 T C 7: 3,240,805 H359R probably damaging Het
Olfr1495 A T 19: 13,768,357 N5I probably benign Het
Olfr957 A C 9: 39,511,146 N191K probably benign Het
Rnf10 C A 5: 115,272,261 K51N possibly damaging Het
Scap G A 9: 110,381,286 G921D probably benign Het
Tk2 A T 8: 104,236,818 S140T probably damaging Het
Tmem106b A G 6: 13,084,244 Y249C probably damaging Het
Ttll5 T A 12: 85,876,578 S276R probably damaging Het
Ugt1a7c T C 1: 88,095,356 V79A probably benign Het
Zfp410 T C 12: 84,327,312 V141A possibly damaging Het
Other mutations in Nox3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Nox3 APN 17 3683015 missense probably damaging 0.99
IGL01135:Nox3 APN 17 3696252 utr 5 prime probably benign
IGL01791:Nox3 APN 17 3682943 missense possibly damaging 0.68
IGL02423:Nox3 APN 17 3682916 missense probably damaging 1.00
IGL03091:Nox3 APN 17 3665844 missense probably benign 0.42
R0046:Nox3 UTSW 17 3682961 missense probably benign 0.08
R0046:Nox3 UTSW 17 3682961 missense probably benign 0.08
R0085:Nox3 UTSW 17 3635281 missense probably benign 0.14
R0426:Nox3 UTSW 17 3695563 missense probably damaging 1.00
R0690:Nox3 UTSW 17 3695564 missense probably damaging 1.00
R1281:Nox3 UTSW 17 3696185 missense probably damaging 1.00
R1350:Nox3 UTSW 17 3650121 missense probably damaging 1.00
R1843:Nox3 UTSW 17 3669878 missense probably damaging 1.00
R1902:Nox3 UTSW 17 3670017 missense probably damaging 1.00
R2023:Nox3 UTSW 17 3694021 splice site probably benign
R2762:Nox3 UTSW 17 3696158 missense probably benign 0.35
R2872:Nox3 UTSW 17 3682916 missense probably damaging 1.00
R2872:Nox3 UTSW 17 3682916 missense probably damaging 1.00
R4429:Nox3 UTSW 17 3682958 missense probably benign 0.05
R4630:Nox3 UTSW 17 3693982 missense possibly damaging 0.53
R4926:Nox3 UTSW 17 3669894 missense probably damaging 1.00
R4928:Nox3 UTSW 17 3635275 missense probably null 1.00
R5181:Nox3 UTSW 17 3635286 nonsense probably null
R6911:Nox3 UTSW 17 3685923 missense probably damaging 1.00
R6912:Nox3 UTSW 17 3685923 missense probably damaging 1.00
R7486:Nox3 UTSW 17 3669944 missense probably damaging 1.00
R7529:Nox3 UTSW 17 3671775 missense probably damaging 0.99
R8355:Nox3 UTSW 17 3685923 missense probably damaging 1.00
R8455:Nox3 UTSW 17 3685923 missense probably damaging 1.00
R8457:Nox3 UTSW 17 3685923 missense probably damaging 1.00
R9028:Nox3 UTSW 17 3665910 missense possibly damaging 0.62
R9128:Nox3 UTSW 17 3669861 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGAAACCTCTTTTATCCAGC -3'
(R):5'- TTCAAGACACTGGGAGAGATGC -3'

Sequencing Primer
(F):5'- TTATCCAGCTCTTTTATGTGAAGC -3'
(R):5'- AATTCCTTGTAGACTGCCAGAGC -3'
Posted On 2020-09-02