Incidental Mutation 'R8358:Olfr1484'
ID645890
Institutional Source Beutler Lab
Gene Symbol Olfr1484
Ensembl Gene ENSMUSG00000096289
Gene Nameolfactory receptor 1484
SynonymsMOR202-37, GA_x6K02T2RE5P-3917859-3918806
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R8358 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location13583511-13588832 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13585400 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 32 (L32P)
Ref Sequence ENSEMBL: ENSMUSP00000150019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074180] [ENSMUST00000208104] [ENSMUST00000215567] [ENSMUST00000216014] [ENSMUST00000216369] [ENSMUST00000217451]
Predicted Effect probably damaging
Transcript: ENSMUST00000074180
AA Change: L32P

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073811
Gene: ENSMUSG00000096289
AA Change: L32P

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 7.4e-55 PFAM
Pfam:7TM_GPCR_Srsx 34 304 1.1e-5 PFAM
Pfam:7tm_1 40 289 3.7e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208104
Predicted Effect probably damaging
Transcript: ENSMUST00000215567
AA Change: L32P

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000216014
AA Change: L32P

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000216369
Predicted Effect probably damaging
Transcript: ENSMUST00000217451
AA Change: L32P

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,326,578 T374I probably damaging Het
Abcf3 T C 16: 20,549,046 S52P possibly damaging Het
Adamts19 G T 18: 59,048,809 G1107C probably damaging Het
Afap1 A T 5: 35,974,486 T386S probably benign Het
Alg12 T C 15: 88,811,300 Y331C probably null Het
Aste1 T A 9: 105,397,056 I165N probably damaging Het
Atp13a5 A G 16: 29,348,987 I118T probably damaging Het
AW551984 A G 9: 39,599,355 V228A probably damaging Het
Cachd1 A G 4: 100,959,471 Y357C possibly damaging Het
Cacul1 T A 19: 60,563,235 H183L possibly damaging Het
Casp16-ps T A 17: 23,553,374 I39F probably damaging Het
Chd7 G T 4: 8,839,529 C1355F probably damaging Het
Ctif G A 18: 75,565,044 H182Y possibly damaging Het
Cubn C T 2: 13,325,160 V2637I probably benign Het
Dlx1 T A 2: 71,530,308 probably null Het
Dsp A G 13: 38,192,481 N1414S possibly damaging Het
Erich6 A T 3: 58,637,028 L46* probably null Het
Fcho2 G A 13: 98,725,774 R804* probably null Het
Gas7 T A 11: 67,652,908 I114N probably benign Het
Gpr137b T C 13: 13,359,344 T376A probably benign Het
H2-T24 T C 17: 36,017,337 M85V probably benign Het
Klk1b16 T A 7: 44,140,761 C152S probably damaging Het
Lrrc31 G A 3: 30,699,783 probably benign Het
Magt1 C T X: 105,996,895 A100T probably benign Het
Mki67 T C 7: 135,700,126 K1060E possibly damaging Het
Nif3l1 A T 1: 58,452,129 T213S probably benign Het
Oasl1 T A 5: 114,937,406 F508L probably benign Het
Olfr1253 C T 2: 89,752,079 V250I probably benign Het
Olfr1329 A T 4: 118,916,526 *314R probably null Het
Olfr447 T C 6: 42,912,042 V173A possibly damaging Het
Psg23 T C 7: 18,614,597 D95G probably benign Het
Ptprr T C 10: 116,048,275 I79T probably benign Het
Rhbg T A 3: 88,245,218 N340Y probably damaging Het
Sash1 C A 10: 8,729,981 V882L probably benign Het
Sharpin C T 15: 76,347,997 V220I probably damaging Het
Slc22a22 T A 15: 57,244,847 D524V probably damaging Het
Slc43a3 T C 2: 84,950,516 Y362H probably benign Het
Slc4a3 T A 1: 75,553,715 D687E probably damaging Het
Slco1a5 A G 6: 142,262,685 S127P probably benign Het
Spg11 T C 2: 122,080,258 I1213V possibly damaging Het
Synj2 T A 17: 6,023,805 Y813* probably null Het
Tbc1d10a T C 11: 4,205,837 M131T probably damaging Het
Tnfrsf19 C A 14: 60,971,185 V296F probably benign Het
Trim45 T C 3: 100,927,318 V439A probably damaging Het
Trim54 A G 5: 31,136,994 T325A probably benign Het
Usp40 T C 1: 87,981,048 E577G possibly damaging Het
Uts2r T A 11: 121,160,519 Y70N probably damaging Het
Vmn1r72 T G 7: 11,670,383 D46A probably damaging Het
Zfc3h1 T C 10: 115,404,293 V577A probably benign Het
Zfp987 T G 4: 146,124,773 H258Q probably damaging Het
Other mutations in Olfr1484
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02029:Olfr1484 APN 19 13586104 missense probably benign 0.05
IGL02104:Olfr1484 APN 19 13585604 missense probably damaging 0.99
IGL02502:Olfr1484 APN 19 13585748 missense probably damaging 1.00
IGL03339:Olfr1484 APN 19 13586075 missense probably damaging 0.99
IGL03391:Olfr1484 APN 19 13586119 missense probably benign
R0008:Olfr1484 UTSW 19 13585876 missense probably benign 0.01
R0607:Olfr1484 UTSW 19 13586170 missense probably damaging 1.00
R0892:Olfr1484 UTSW 19 13585517 missense probably damaging 1.00
R1170:Olfr1484 UTSW 19 13586213 missense probably benign 0.00
R1605:Olfr1484 UTSW 19 13585630 missense probably benign 0.00
R1619:Olfr1484 UTSW 19 13585614 missense probably benign 0.03
R1793:Olfr1484 UTSW 19 13585415 missense probably benign 0.42
R2073:Olfr1484 UTSW 19 13585601 missense probably damaging 1.00
R2348:Olfr1484 UTSW 19 13586189 missense probably damaging 0.99
R5025:Olfr1484 UTSW 19 13585522 missense probably benign 0.03
R5383:Olfr1484 UTSW 19 13586075 missense probably damaging 0.99
R5771:Olfr1484 UTSW 19 13585508 missense probably damaging 0.98
R6002:Olfr1484 UTSW 19 13585417 start gained probably benign
R6992:Olfr1484 UTSW 19 13585447 missense possibly damaging 0.57
R7404:Olfr1484 UTSW 19 13585388 missense possibly damaging 0.88
RF002:Olfr1484 UTSW 19 13586051 missense probably damaging 1.00
X0019:Olfr1484 UTSW 19 13586208 missense probably null 0.00
X0019:Olfr1484 UTSW 19 13586209 missense probably damaging 1.00
X0040:Olfr1484 UTSW 19 13586208 missense probably null 0.00
X0040:Olfr1484 UTSW 19 13586209 missense probably damaging 1.00
X0067:Olfr1484 UTSW 19 13586072 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACACTGTACAGGATGCTGAC -3'
(R):5'- AGCACATGCATTGTAGGATATGATC -3'

Sequencing Primer
(F):5'- CACTGTACAGGATGCTGACACATG -3'
(R):5'- TGATCTTATTTTCTGTGAGAAACCC -3'
Posted On2020-09-02