Incidental Mutation 'R8359:Upp2'
ID645894
Institutional Source Beutler Lab
Gene Symbol Upp2
Ensembl Gene ENSMUSG00000026839
Gene Nameuridine phosphorylase 2
SynonymsUDRPASE2, UP2, UPASE2, 1700124F02Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R8359 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location58567298-58792971 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58777943 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 216 (N216S)
Ref Sequence ENSEMBL: ENSMUSP00000060437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059102] [ENSMUST00000071543] [ENSMUST00000102755] [ENSMUST00000229923] [ENSMUST00000230627]
Predicted Effect probably benign
Transcript: ENSMUST00000059102
AA Change: N216S

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000060437
Gene: ENSMUSG00000026839
AA Change: N216S

DomainStartEndE-ValueType
Pfam:PNP_UDP_1 78 328 6.4e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071543
AA Change: N236S

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000071474
Gene: ENSMUSG00000026839
AA Change: N236S

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:PNP_UDP_1 98 316 7.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102755
AA Change: N198S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000099816
Gene: ENSMUSG00000026839
AA Change: N198S

DomainStartEndE-ValueType
Pfam:PNP_UDP_1 60 310 4.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229923
AA Change: N198S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000230627
AA Change: N164S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A T 8: 24,806,486 V315D probably damaging Het
Adgrf1 A T 17: 43,310,395 I508F probably damaging Het
Atpaf2 T C 11: 60,407,303 D147G probably damaging Het
Brwd1 T C 16: 96,016,209 T1368A probably damaging Het
Cacna1s A T 1: 136,116,061 E1626V probably benign Het
Carm1 G A 9: 21,569,469 V80I possibly damaging Het
Casc4 A T 2: 121,867,151 probably benign Het
Cenpw T A 10: 30,198,488 D71V probably damaging Het
Ckmt1 A T 2: 121,363,050 T364S probably benign Het
Col6a4 T C 9: 106,068,384 S844G probably benign Het
Crybg1 T C 10: 43,992,542 E1380G probably benign Het
Cyp21a1 A G 17: 34,802,131 probably null Het
D430042O09Rik T C 7: 125,868,851 probably null Het
Dhodh A C 8: 109,606,406 D12E probably benign Het
Dnali1 T A 4: 125,063,667 T95S probably damaging Het
Dynlrb1 A G 2: 155,249,950 N93D probably benign Het
Edem1 C T 6: 108,846,813 A390V probably benign Het
Enthd1 T C 15: 80,474,155 D388G probably benign Het
Fam170a A G 18: 50,281,610 T108A probably damaging Het
Fryl A G 5: 73,075,933 S1531P probably benign Het
Hspbap1 C A 16: 35,824,996 N350K probably benign Het
Htr3b A C 9: 48,947,296 S94R probably damaging Het
Ide A T 19: 37,330,487 V42E Het
Igf2r A G 17: 12,683,861 V2434A probably benign Het
Kif16b G A 2: 142,711,857 A1007V probably benign Het
Mccc1 C T 3: 35,964,344 V614I probably benign Het
Mos A G 4: 3,871,097 Y240H probably damaging Het
Myh11 C T 16: 14,208,231 probably null Het
Nexn T A 3: 152,248,361 D166V probably damaging Het
Olfr328 G T 11: 58,552,203 T12N probably benign Het
Olfr510 T A 7: 108,668,311 N298K probably benign Het
Olfr55 G A 17: 33,176,921 C173Y probably damaging Het
Pkp4 A G 2: 59,350,551 Y1061C probably damaging Het
Pla2g6 T C 15: 79,287,170 D740G probably damaging Het
Pla2r1 T A 2: 60,443,283 I920L probably benign Het
Plekha2 A G 8: 25,088,391 I31T probably damaging Het
Ppp1r16b G T 2: 158,761,375 V407L probably benign Het
Prss50 A G 9: 110,862,302 I225V probably damaging Het
Rmdn2 A T 17: 79,628,151 E231V Het
Sema3c T C 5: 17,653,728 S42P possibly damaging Het
Slc22a20 T C 19: 5,971,526 I483V probably benign Het
Slc30a2 T C 4: 134,349,379 V275A probably damaging Het
Slc6a3 T A 13: 73,544,883 F207L probably benign Het
Slc9a1 A T 4: 133,420,616 Q648H probably damaging Het
Slpi A T 2: 164,356,055 M1K probably null Het
Smc5 A C 19: 23,234,079 S564A possibly damaging Het
Smchd1 A T 17: 71,431,243 F542L probably damaging Het
Sycp1 T A 3: 102,820,593 K901N probably damaging Het
Synpo2l T A 14: 20,666,140 T126S probably benign Het
Wnk1 T C 6: 119,992,447 D349G probably damaging Het
Zfp180 C T 7: 24,104,912 A252V probably benign Het
Zfr2 C T 10: 81,242,819 T295I possibly damaging Het
Zkscan16 C T 4: 58,957,230 T504I possibly damaging Het
Other mutations in Upp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Upp2 APN 2 58790064 missense probably benign 0.43
IGL01716:Upp2 APN 2 58790046 missense probably damaging 0.99
IGL02069:Upp2 APN 2 58771417 splice site probably benign
IGL02349:Upp2 APN 2 58777886 missense probably benign 0.03
IGL03072:Upp2 APN 2 58755423 critical splice donor site probably null
R0815:Upp2 UTSW 2 58771556 missense probably benign 0.00
R1164:Upp2 UTSW 2 58763704 missense probably damaging 1.00
R1400:Upp2 UTSW 2 58790106 missense probably damaging 1.00
R1553:Upp2 UTSW 2 58790140 missense probably damaging 1.00
R1581:Upp2 UTSW 2 58774165 missense possibly damaging 0.93
R1674:Upp2 UTSW 2 58790064 missense probably benign 0.43
R1702:Upp2 UTSW 2 58771550 missense possibly damaging 0.86
R1902:Upp2 UTSW 2 58771452 missense probably damaging 1.00
R2351:Upp2 UTSW 2 58763662 splice site probably null
R3011:Upp2 UTSW 2 58790095 missense probably damaging 0.97
R3622:Upp2 UTSW 2 58790116 missense possibly damaging 0.83
R3623:Upp2 UTSW 2 58790116 missense possibly damaging 0.83
R3731:Upp2 UTSW 2 58755367 missense probably benign 0.02
R4257:Upp2 UTSW 2 58780094 missense probably damaging 1.00
R4296:Upp2 UTSW 2 58778009 missense probably damaging 1.00
R4768:Upp2 UTSW 2 58777895 missense probably damaging 0.99
R5116:Upp2 UTSW 2 58771542 missense probably damaging 1.00
R5638:Upp2 UTSW 2 58790095 missense probably damaging 0.97
R7100:Upp2 UTSW 2 58791805 missense probably benign
R7421:Upp2 UTSW 2 58771574 missense possibly damaging 0.49
R7727:Upp2 UTSW 2 58774148 missense possibly damaging 0.95
R7840:Upp2 UTSW 2 58774115 critical splice acceptor site probably null
R8033:Upp2 UTSW 2 58780059 missense probably damaging 1.00
R8461:Upp2 UTSW 2 58780056 missense probably benign 0.02
R8510:Upp2 UTSW 2 58780106 missense probably damaging 1.00
Z1177:Upp2 UTSW 2 58780062 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGACCCGAAAGTCAACTCG -3'
(R):5'- AAAGGCTATTTGCTTCCCCTTG -3'

Sequencing Primer
(F):5'- GTCAACTCGAGGCAATCTCCTG -3'
(R):5'- AAGGCTATTTGCTTCCCCTTGAAAAC -3'
Posted On2020-09-02