Mutagenetix > Incidental Mutation

Incidental Mutation 'R8359:Pla2r1'

645896

Institutional Source

Beutler Lab

Gene Symbol

Pla2r1

Ensembl Gene

ENSMUSG00000054580

Gene Name

phospholipase A2 receptor 1

Synonyms

M-type receptor, Pla2g1br, PLA2-I receptor

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8359 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

60417543-60553308 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 60443283 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 920 (I920L)

Ref Sequence

ENSEMBL: ENSMUSP00000108144 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112525]

AlphaFold

Q62028

Predicted Effect

probably benign
Transcript: ENSMUST00000112525
AA Change: I920L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000108144
Gene: ENSMUSG00000054580
AA Change: I920L

Domain	Start	End	E-Value	Type
low complexity region	35	62	N/A	INTRINSIC
RICIN	77	189	2.98e-16	SMART
FN2	209	257	1.17e-25	SMART
CLECT	267	392	7.66e-30	SMART
CLECT	415	539	1.88e-29	SMART
CLECT	552	679	5.42e-21	SMART
CLECT	699	832	3.58e-21	SMART
CLECT	847	973	7.55e-20	SMART
CLECT	992	1131	5.05e-30	SMART
CLECT	1148	1267	4.72e-21	SMART
CLECT	1281	1412	1.44e-25	SMART
transmembrane domain	1432	1454	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a phospholipase A2 receptor. The encoded protein likely exists as both a transmembrane form and a soluble form. The transmembrane receptor may play a role in clearance of phospholipase A2, thereby inhibiting its action. Polymorphisms at this locus have been associated with susceptibility to idiopathic membranous nephropathy. Alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous null mice are viable and fertile with no overt abnormalities. These mice are more resistant to toxic effects of lipopolysaccharide than controls, suggesting a role for this gene in the progression of endotoxic shock. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam5	A	T	8: 24,806,486	V315D	probably damaging	Het
Adgrf1	A	T	17: 43,310,395	I508F	probably damaging	Het
Atpaf2	T	C	11: 60,407,303	D147G	probably damaging	Het
Brwd1	T	C	16: 96,016,209	T1368A	probably damaging	Het
Cacna1s	A	T	1: 136,116,061	E1626V	probably benign	Het
Carm1	G	A	9: 21,569,469	V80I	possibly damaging	Het
Casc4	A	T	2: 121,867,151		probably benign	Het
Cenpw	T	A	10: 30,198,488	D71V	probably damaging	Het
Cit	T	A	5: 115,984,544		probably null	Het
Ckmt1	A	T	2: 121,363,050	T364S	probably benign	Het
Col6a4	T	C	9: 106,068,384	S844G	probably benign	Het
Crybg1	T	C	10: 43,992,542	E1380G	probably benign	Het
Cyp21a1	A	G	17: 34,802,131		probably null	Het
D430042O09Rik	T	C	7: 125,868,851		probably null	Het
Dhodh	A	C	8: 109,606,406	D12E	probably benign	Het
Dnali1	T	A	4: 125,063,667	T95S	probably damaging	Het
Dynlrb1	A	G	2: 155,249,950	N93D	probably benign	Het
Edem1	C	T	6: 108,846,813	A390V	probably benign	Het
Enthd1	T	C	15: 80,474,155	D388G	probably benign	Het
Fam170a	A	G	18: 50,281,610	T108A	probably damaging	Het
Fryl	A	G	5: 73,075,933	S1531P	probably benign	Het
Hspbap1	C	A	16: 35,824,996	N350K	probably benign	Het
Htr3b	A	C	9: 48,947,296	S94R	probably damaging	Het
Ide	A	T	19: 37,330,487	V42E		Het
Igf2r	A	G	17: 12,683,861	V2434A	probably benign	Het
Kif16b	G	A	2: 142,711,857	A1007V	probably benign	Het
Mccc1	C	T	3: 35,964,344	V614I	probably benign	Het
Mos	A	G	4: 3,871,097	Y240H	probably damaging	Het
Myh11	C	T	16: 14,208,231		probably null	Het
Nexn	T	A	3: 152,248,361	D166V	probably damaging	Het
Olfr1192-ps1	A	T	2: 88,652,988	M279L	probably benign	Het
Olfr328	G	T	11: 58,552,203	T12N	probably benign	Het
Olfr510	T	A	7: 108,668,311	N298K	probably benign	Het
Olfr55	G	A	17: 33,176,921	C173Y	probably damaging	Het
Pkp4	A	G	2: 59,350,551	Y1061C	probably damaging	Het
Pla2g6	T	C	15: 79,287,170	D740G	probably damaging	Het
Plekha2	A	G	8: 25,088,391	I31T	probably damaging	Het
Ppp1r16b	G	T	2: 158,761,375	V407L	probably benign	Het
Prss50	A	G	9: 110,862,302	I225V	probably damaging	Het
Rmdn2	A	T	17: 79,628,151	E231V		Het
Sema3c	T	C	5: 17,653,728	S42P	possibly damaging	Het
Sh2d1b1	T	A	1: 170,283,124		probably null	Het
Slc22a20	T	C	19: 5,971,526	I483V	probably benign	Het
Slc30a2	T	C	4: 134,349,379	V275A	probably damaging	Het
Slc6a3	T	A	13: 73,544,883	F207L	probably benign	Het
Slc9a1	A	T	4: 133,420,616	Q648H	probably damaging	Het
Slpi	A	T	2: 164,356,055	M1K	probably null	Het
Smc5	A	C	19: 23,234,079	S564A	possibly damaging	Het
Smchd1	A	T	17: 71,431,243	F542L	probably damaging	Het
Sycp1	T	A	3: 102,820,593	K901N	probably damaging	Het
Synpo2l	T	A	14: 20,666,140	T126S	probably benign	Het
Upp2	A	G	2: 58,777,943	N216S	probably benign	Het
Wnk1	T	C	6: 119,992,447	D349G	probably damaging	Het
Zfp180	C	T	7: 24,104,912	A252V	probably benign	Het
Zfr2	C	T	10: 81,242,819	T295I	possibly damaging	Het
Zkscan16	C	T	4: 58,957,230	T504I	possibly damaging	Het

Other mutations in Pla2r1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00569:Pla2r1	APN	2	60420425	missense	probably benign
IGL00886:Pla2r1	APN	2	60424324	missense	probably damaging	1.00
IGL00928:Pla2r1	APN	2	60535080	missense	probably damaging	0.99
IGL01361:Pla2r1	APN	2	60479470	missense	probably damaging	1.00
IGL01403:Pla2r1	APN	2	60424288	missense	probably damaging	0.99
IGL01475:Pla2r1	APN	2	60441081	splice site	probably benign
IGL01517:Pla2r1	APN	2	60504253	missense	probably damaging	1.00
IGL01646:Pla2r1	APN	2	60495364	missense	probably damaging	1.00
IGL02208:Pla2r1	APN	2	60428588	missense	possibly damaging	0.81
IGL02301:Pla2r1	APN	2	60452436	missense	probably benign	0.01
IGL02522:Pla2r1	APN	2	60428669	missense	probably benign	0.11
IGL02688:Pla2r1	APN	2	60455201	missense	probably damaging	1.00
IGL02822:Pla2r1	APN	2	60455173	missense	probably damaging	1.00
IGL02850:Pla2r1	APN	2	60502069	missense	probably benign	0.03
IGL03233:Pla2r1	APN	2	60428580	missense	possibly damaging	0.63
IGL03350:Pla2r1	APN	2	60455173	missense	probably damaging	1.00
IGL02980:Pla2r1	UTSW	2	60515046	missense	possibly damaging	0.77
R0105:Pla2r1	UTSW	2	60514981	missense	possibly damaging	0.89
R0105:Pla2r1	UTSW	2	60514981	missense	possibly damaging	0.89
R0387:Pla2r1	UTSW	2	60432601	missense	probably benign	0.03
R0522:Pla2r1	UTSW	2	60479515	missense	probably benign	0.01
R0550:Pla2r1	UTSW	2	60425350	critical splice donor site	probably null
R0718:Pla2r1	UTSW	2	60479530	missense	possibly damaging	0.55
R0906:Pla2r1	UTSW	2	60514947	missense	possibly damaging	0.79
R0945:Pla2r1	UTSW	2	60458410	missense	possibly damaging	0.89
R1229:Pla2r1	UTSW	2	60534762	missense	probably benign	0.09
R1397:Pla2r1	UTSW	2	60534762	missense	probably benign	0.09
R1667:Pla2r1	UTSW	2	60420257	missense	probably benign	0.00
R1668:Pla2r1	UTSW	2	60428646	missense	probably damaging	0.99
R1694:Pla2r1	UTSW	2	60441084	critical splice donor site	probably null
R1864:Pla2r1	UTSW	2	60428711	missense	probably benign	0.01
R2029:Pla2r1	UTSW	2	60431973	missense	probably damaging	0.99
R2035:Pla2r1	UTSW	2	60422736	missense	probably damaging	1.00
R2207:Pla2r1	UTSW	2	60458435	missense	probably damaging	1.00
R2429:Pla2r1	UTSW	2	60514968	missense	probably damaging	1.00
R3196:Pla2r1	UTSW	2	60522783	missense	probably damaging	1.00
R3522:Pla2r1	UTSW	2	60448906	missense	probably damaging	1.00
R3973:Pla2r1	UTSW	2	60448962	missense	probably benign	0.30
R4006:Pla2r1	UTSW	2	60522873	missense	probably damaging	1.00
R4091:Pla2r1	UTSW	2	60432593	missense	probably damaging	1.00
R4158:Pla2r1	UTSW	2	60422622	missense	probably damaging	0.97
R4160:Pla2r1	UTSW	2	60422622	missense	probably damaging	0.97
R4168:Pla2r1	UTSW	2	60497614	nonsense	probably null
R4541:Pla2r1	UTSW	2	60427738	missense	probably damaging	1.00
R4712:Pla2r1	UTSW	2	60428650	missense	probably damaging	1.00
R4797:Pla2r1	UTSW	2	60504180	missense	possibly damaging	0.47
R4884:Pla2r1	UTSW	2	60534984	missense	probably damaging	1.00
R4923:Pla2r1	UTSW	2	60422712	missense	probably benign	0.31
R5017:Pla2r1	UTSW	2	60522760	splice site	probably null
R5116:Pla2r1	UTSW	2	60448906	missense	probably damaging	1.00
R5641:Pla2r1	UTSW	2	60514984	missense	probably damaging	1.00
R5807:Pla2r1	UTSW	2	60428721	missense	possibly damaging	0.78
R5898:Pla2r1	UTSW	2	60422760	missense	probably damaging	1.00
R6241:Pla2r1	UTSW	2	60502199	splice site	probably null
R6923:Pla2r1	UTSW	2	60514966	missense	probably benign	0.11
R7020:Pla2r1	UTSW	2	60447399	missense	possibly damaging	0.79
R7028:Pla2r1	UTSW	2	60458393	missense	probably damaging	0.98
R7257:Pla2r1	UTSW	2	60427625	critical splice donor site	probably null
R7291:Pla2r1	UTSW	2	60530435	missense	probably benign	0.43
R7350:Pla2r1	UTSW	2	60458379	missense	probably benign	0.02
R7451:Pla2r1	UTSW	2	60535002	missense	probably damaging	1.00
R7553:Pla2r1	UTSW	2	60522899	missense	possibly damaging	0.80
R7635:Pla2r1	UTSW	2	60534762	missense	probably benign	0.09
R7768:Pla2r1	UTSW	2	60448946	missense	probably benign	0.22
R7774:Pla2r1	UTSW	2	60530458	nonsense	probably null
R7782:Pla2r1	UTSW	2	60504187	missense	probably benign	0.01
R7832:Pla2r1	UTSW	2	60504192	missense	possibly damaging	0.79
R7843:Pla2r1	UTSW	2	60447475	missense	possibly damaging	0.88
R7900:Pla2r1	UTSW	2	60428514	missense	possibly damaging	0.94
R8010:Pla2r1	UTSW	2	60514960	missense	probably benign	0.00
R8129:Pla2r1	UTSW	2	60432600	missense	probably damaging	1.00
R8336:Pla2r1	UTSW	2	60422683	missense	possibly damaging	0.88
R8347:Pla2r1	UTSW	2	60534903	missense	probably damaging	0.98
R8682:Pla2r1	UTSW	2	60422776	missense	possibly damaging	0.89
R8845:Pla2r1	UTSW	2	60428709	missense	possibly damaging	0.52
R8901:Pla2r1	UTSW	2	60502056	missense
R9085:Pla2r1	UTSW	2	60425447	missense	probably damaging	0.99
R9130:Pla2r1	UTSW	2	60495385	intron	probably benign
R9140:Pla2r1	UTSW	2	60441111	missense	probably benign	0.10
R9399:Pla2r1	UTSW	2	60452400	critical splice donor site	probably null
R9449:Pla2r1	UTSW	2	60428558	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTTGGCTCTTGAGGACTTACC -3'
(R):5'- GATACTGAACATGCAAAATGAGACC -3'

Sequencing Primer
(F):5'- GTAAGTTTACAGGCATGTGAGTAC -3'
(R):5'- TCCAGCTCAAGGAGATCTGATGC -3'

Posted On

2020-09-02