Incidental Mutation 'R8359:Ckmt1'
ID645897
Institutional Source Beutler Lab
Gene Symbol Ckmt1
Ensembl Gene ENSMUSG00000000308
Gene Namecreatine kinase, mitochondrial 1, ubiquitous
Synonymsmi-CK, UbCKmit, Mt-CK
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R8359 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location121357714-121363737 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121363050 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 364 (T364S)
Ref Sequence ENSEMBL: ENSMUSP00000000317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000317] [ENSMUST00000038389] [ENSMUST00000078222] [ENSMUST00000125221] [ENSMUST00000125812] [ENSMUST00000126130] [ENSMUST00000128612] [ENSMUST00000129130] [ENSMUST00000150271]
Predicted Effect probably benign
Transcript: ENSMUST00000000317
AA Change: T364S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000000317
Gene: ENSMUSG00000000308
AA Change: T364S

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
Pfam:ATP-gua_PtransN 58 133 5.8e-34 PFAM
Pfam:ATP-gua_Ptrans 154 401 4.5e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038389
SMART Domains Protein: ENSMUSP00000039378
Gene: ENSMUSG00000033498

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 74 87 N/A INTRINSIC
low complexity region 108 119 N/A INTRINSIC
low complexity region 132 161 N/A INTRINSIC
low complexity region 277 291 N/A INTRINSIC
low complexity region 376 425 N/A INTRINSIC
low complexity region 610 635 N/A INTRINSIC
low complexity region 656 677 N/A INTRINSIC
low complexity region 728 746 N/A INTRINSIC
low complexity region 898 921 N/A INTRINSIC
low complexity region 1168 1194 N/A INTRINSIC
low complexity region 1287 1302 N/A INTRINSIC
low complexity region 1560 1580 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078222
AA Change: T364S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000077349
Gene: ENSMUSG00000000308
AA Change: T364S

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
Pfam:ATP-gua_PtransN 55 134 1.2e-37 PFAM
Pfam:ATP-gua_Ptrans 154 401 2e-105 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125221
SMART Domains Protein: ENSMUSP00000121930
Gene: ENSMUSG00000000308

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
Pfam:ATP-gua_PtransN 55 117 5.9e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125812
SMART Domains Protein: ENSMUSP00000115501
Gene: ENSMUSG00000000308

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
Pfam:ATP-gua_PtransN 55 134 9.7e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126130
SMART Domains Protein: ENSMUSP00000117463
Gene: ENSMUSG00000000308

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
low complexity region 39 54 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128612
SMART Domains Protein: ENSMUSP00000115610
Gene: ENSMUSG00000000308

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
low complexity region 47 63 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129130
SMART Domains Protein: ENSMUSP00000123130
Gene: ENSMUSG00000000308

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
Pfam:ATP-gua_PtransN 86 165 5.7e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150271
SMART Domains Protein: ENSMUSP00000120507
Gene: ENSMUSG00000000308

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
Pfam:ATP-gua_PtransN 55 134 3.3e-38 PFAM
Pfam:ATP-gua_Ptrans 154 251 3.8e-34 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele have no visual or motor impairments but display diminished open field habituation and slower spatial learning acquisition in the Morris water maze task as well as a reduced acoustic startle response, higher threshold, and lack of prepulse inhibition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A T 8: 24,806,486 V315D probably damaging Het
Adgrf1 A T 17: 43,310,395 I508F probably damaging Het
Atpaf2 T C 11: 60,407,303 D147G probably damaging Het
Brwd1 T C 16: 96,016,209 T1368A probably damaging Het
Cacna1s A T 1: 136,116,061 E1626V probably benign Het
Carm1 G A 9: 21,569,469 V80I possibly damaging Het
Casc4 A T 2: 121,867,151 probably benign Het
Cenpw T A 10: 30,198,488 D71V probably damaging Het
Col6a4 T C 9: 106,068,384 S844G probably benign Het
Crybg1 T C 10: 43,992,542 E1380G probably benign Het
Cyp21a1 A G 17: 34,802,131 probably null Het
D430042O09Rik T C 7: 125,868,851 probably null Het
Dhodh A C 8: 109,606,406 D12E probably benign Het
Dnali1 T A 4: 125,063,667 T95S probably damaging Het
Dynlrb1 A G 2: 155,249,950 N93D probably benign Het
Edem1 C T 6: 108,846,813 A390V probably benign Het
Enthd1 T C 15: 80,474,155 D388G probably benign Het
Fam170a A G 18: 50,281,610 T108A probably damaging Het
Fryl A G 5: 73,075,933 S1531P probably benign Het
Hspbap1 C A 16: 35,824,996 N350K probably benign Het
Htr3b A C 9: 48,947,296 S94R probably damaging Het
Ide A T 19: 37,330,487 V42E Het
Igf2r A G 17: 12,683,861 V2434A probably benign Het
Kif16b G A 2: 142,711,857 A1007V probably benign Het
Mccc1 C T 3: 35,964,344 V614I probably benign Het
Mos A G 4: 3,871,097 Y240H probably damaging Het
Myh11 C T 16: 14,208,231 probably null Het
Nexn T A 3: 152,248,361 D166V probably damaging Het
Olfr328 G T 11: 58,552,203 T12N probably benign Het
Olfr510 T A 7: 108,668,311 N298K probably benign Het
Olfr55 G A 17: 33,176,921 C173Y probably damaging Het
Pkp4 A G 2: 59,350,551 Y1061C probably damaging Het
Pla2g6 T C 15: 79,287,170 D740G probably damaging Het
Pla2r1 T A 2: 60,443,283 I920L probably benign Het
Plekha2 A G 8: 25,088,391 I31T probably damaging Het
Ppp1r16b G T 2: 158,761,375 V407L probably benign Het
Prss50 A G 9: 110,862,302 I225V probably damaging Het
Rmdn2 A T 17: 79,628,151 E231V Het
Sema3c T C 5: 17,653,728 S42P possibly damaging Het
Slc22a20 T C 19: 5,971,526 I483V probably benign Het
Slc30a2 T C 4: 134,349,379 V275A probably damaging Het
Slc6a3 T A 13: 73,544,883 F207L probably benign Het
Slc9a1 A T 4: 133,420,616 Q648H probably damaging Het
Slpi A T 2: 164,356,055 M1K probably null Het
Smc5 A C 19: 23,234,079 S564A possibly damaging Het
Smchd1 A T 17: 71,431,243 F542L probably damaging Het
Sycp1 T A 3: 102,820,593 K901N probably damaging Het
Synpo2l T A 14: 20,666,140 T126S probably benign Het
Upp2 A G 2: 58,777,943 N216S probably benign Het
Wnk1 T C 6: 119,992,447 D349G probably damaging Het
Zfp180 C T 7: 24,104,912 A252V probably benign Het
Zfr2 C T 10: 81,242,819 T295I possibly damaging Het
Zkscan16 C T 4: 58,957,230 T504I possibly damaging Het
Other mutations in Ckmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Ckmt1 APN 2 121361150 missense probably damaging 1.00
IGL01141:Ckmt1 APN 2 121362993 missense probably benign 0.07
IGL01403:Ckmt1 APN 2 121362966 unclassified probably benign
IGL01971:Ckmt1 APN 2 121363583 missense probably benign 0.41
IGL02037:Ckmt1 APN 2 121361162 missense probably damaging 0.99
IGL02750:Ckmt1 APN 2 121363615 unclassified probably benign
IGL03303:Ckmt1 APN 2 121360005 missense probably benign
R0157:Ckmt1 UTSW 2 121363041 missense possibly damaging 0.86
R0331:Ckmt1 UTSW 2 121362856 splice site probably null
R1590:Ckmt1 UTSW 2 121363522 missense possibly damaging 0.96
R1640:Ckmt1 UTSW 2 121359717 splice site probably null
R1853:Ckmt1 UTSW 2 121360650 missense probably damaging 1.00
R4726:Ckmt1 UTSW 2 121361231 critical splice donor site probably null
R4788:Ckmt1 UTSW 2 121359946 missense possibly damaging 0.87
R5632:Ckmt1 UTSW 2 121360592 missense probably damaging 1.00
R5633:Ckmt1 UTSW 2 121363629 unclassified probably benign
R5960:Ckmt1 UTSW 2 121363577 missense probably damaging 1.00
R6123:Ckmt1 UTSW 2 121363579 missense probably benign 0.05
R6673:Ckmt1 UTSW 2 121359670 missense probably damaging 1.00
R7220:Ckmt1 UTSW 2 121358893 missense possibly damaging 0.96
R8100:Ckmt1 UTSW 2 121360777 missense probably benign
R8508:Ckmt1 UTSW 2 121362691 missense possibly damaging 0.64
R8512:Ckmt1 UTSW 2 121361208 missense probably damaging 1.00
X0067:Ckmt1 UTSW 2 121360967 nonsense probably null
Z1177:Ckmt1 UTSW 2 121359575 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACTGCCACTGCTGAGCAAAG -3'
(R):5'- TAGCTCTTCCATCTCTGAAAACTCG -3'

Sequencing Primer
(F):5'- CTGCCACTGCTGAGCAAAGTAAAG -3'
(R):5'- AAAACTCGTTTTCTCTTCCCTCC -3'
Posted On2020-09-02