Incidental Mutation 'R8359:Kif16b'
ID645899
Institutional Source Beutler Lab
Gene Symbol Kif16b
Ensembl Gene ENSMUSG00000038844
Gene Namekinesin family member 16B
Synonyms8430434E15Rik, N-3 kinesin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8359 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location142617474-142901531 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 142711857 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 1007 (A1007V)
Ref Sequence ENSEMBL: ENSMUSP00000042551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043589] [ENSMUST00000211861] [ENSMUST00000230763]
Predicted Effect probably benign
Transcript: ENSMUST00000043589
AA Change: A1007V

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000042551
Gene: ENSMUSG00000038844
AA Change: A1007V

DomainStartEndE-ValueType
KISc 1 366 4.87e-173 SMART
FHA 477 529 1.43e-1 SMART
coiled coil region 597 809 N/A INTRINSIC
coiled coil region 835 858 N/A INTRINSIC
coiled coil region 941 1022 N/A INTRINSIC
PX 1179 1281 1.58e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000211861
AA Change: A1007V

PolyPhen 2 Score 0.544 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000230763
AA Change: A1018V

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kinesin-like protein that may be involved in intracellular trafficking. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Chimera embryos containing a knock-out allele and derived from tetraploid rescue exhibit lethal growth arrest at the blastocyst stage with abnormal development of the primitive endoderm, epiblast epithelium, and basement membrane. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A T 8: 24,806,486 V315D probably damaging Het
Adgrf1 A T 17: 43,310,395 I508F probably damaging Het
Atpaf2 T C 11: 60,407,303 D147G probably damaging Het
Brwd1 T C 16: 96,016,209 T1368A probably damaging Het
Cacna1s A T 1: 136,116,061 E1626V probably benign Het
Carm1 G A 9: 21,569,469 V80I possibly damaging Het
Casc4 A T 2: 121,867,151 probably benign Het
Cenpw T A 10: 30,198,488 D71V probably damaging Het
Ckmt1 A T 2: 121,363,050 T364S probably benign Het
Col6a4 T C 9: 106,068,384 S844G probably benign Het
Crybg1 T C 10: 43,992,542 E1380G probably benign Het
Cyp21a1 A G 17: 34,802,131 probably null Het
D430042O09Rik T C 7: 125,868,851 probably null Het
Dhodh A C 8: 109,606,406 D12E probably benign Het
Dnali1 T A 4: 125,063,667 T95S probably damaging Het
Dynlrb1 A G 2: 155,249,950 N93D probably benign Het
Edem1 C T 6: 108,846,813 A390V probably benign Het
Enthd1 T C 15: 80,474,155 D388G probably benign Het
Fam170a A G 18: 50,281,610 T108A probably damaging Het
Fryl A G 5: 73,075,933 S1531P probably benign Het
Hspbap1 C A 16: 35,824,996 N350K probably benign Het
Htr3b A C 9: 48,947,296 S94R probably damaging Het
Ide A T 19: 37,330,487 V42E Het
Igf2r A G 17: 12,683,861 V2434A probably benign Het
Mccc1 C T 3: 35,964,344 V614I probably benign Het
Mos A G 4: 3,871,097 Y240H probably damaging Het
Myh11 C T 16: 14,208,231 probably null Het
Nexn T A 3: 152,248,361 D166V probably damaging Het
Olfr328 G T 11: 58,552,203 T12N probably benign Het
Olfr510 T A 7: 108,668,311 N298K probably benign Het
Olfr55 G A 17: 33,176,921 C173Y probably damaging Het
Pkp4 A G 2: 59,350,551 Y1061C probably damaging Het
Pla2g6 T C 15: 79,287,170 D740G probably damaging Het
Pla2r1 T A 2: 60,443,283 I920L probably benign Het
Plekha2 A G 8: 25,088,391 I31T probably damaging Het
Ppp1r16b G T 2: 158,761,375 V407L probably benign Het
Prss50 A G 9: 110,862,302 I225V probably damaging Het
Rmdn2 A T 17: 79,628,151 E231V Het
Sema3c T C 5: 17,653,728 S42P possibly damaging Het
Slc22a20 T C 19: 5,971,526 I483V probably benign Het
Slc30a2 T C 4: 134,349,379 V275A probably damaging Het
Slc6a3 T A 13: 73,544,883 F207L probably benign Het
Slc9a1 A T 4: 133,420,616 Q648H probably damaging Het
Slpi A T 2: 164,356,055 M1K probably null Het
Smc5 A C 19: 23,234,079 S564A possibly damaging Het
Smchd1 A T 17: 71,431,243 F542L probably damaging Het
Sycp1 T A 3: 102,820,593 K901N probably damaging Het
Synpo2l T A 14: 20,666,140 T126S probably benign Het
Upp2 A G 2: 58,777,943 N216S probably benign Het
Wnk1 T C 6: 119,992,447 D349G probably damaging Het
Zfp180 C T 7: 24,104,912 A252V probably benign Het
Zfr2 C T 10: 81,242,819 T295I possibly damaging Het
Zkscan16 C T 4: 58,957,230 T504I possibly damaging Het
Other mutations in Kif16b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Kif16b APN 2 142848035 nonsense probably null
IGL00499:Kif16b APN 2 142857324 missense probably damaging 1.00
IGL00913:Kif16b APN 2 142704007 nonsense probably null
IGL00971:Kif16b APN 2 142711744 missense probably benign 0.01
IGL01712:Kif16b APN 2 142648471 missense probably damaging 1.00
IGL01965:Kif16b APN 2 142848405 missense probably damaging 1.00
IGL02428:Kif16b APN 2 142672360 missense possibly damaging 0.88
IGL02576:Kif16b APN 2 142862545 splice site probably benign
IGL02884:Kif16b APN 2 142702614 splice site probably benign
IGL03065:Kif16b APN 2 142619913 missense probably damaging 1.00
IGL03103:Kif16b APN 2 142862488 missense probably damaging 1.00
IGL03403:Kif16b APN 2 142711869 missense probably damaging 1.00
IGL02835:Kif16b UTSW 2 142712213 missense probably benign 0.00
R0058:Kif16b UTSW 2 142857305 splice site probably null
R0058:Kif16b UTSW 2 142857305 splice site probably null
R0081:Kif16b UTSW 2 142707426 splice site probably benign
R0123:Kif16b UTSW 2 142672375 missense probably benign
R0134:Kif16b UTSW 2 142672375 missense probably benign
R0388:Kif16b UTSW 2 142740937 missense probably damaging 1.00
R0396:Kif16b UTSW 2 142853659 missense probably damaging 1.00
R0502:Kif16b UTSW 2 142712155 missense probably benign 0.00
R1027:Kif16b UTSW 2 142854538 splice site probably benign
R1674:Kif16b UTSW 2 142712953 nonsense probably null
R1752:Kif16b UTSW 2 142690666 missense probably benign 0.01
R2154:Kif16b UTSW 2 142690580 missense probably damaging 1.00
R2262:Kif16b UTSW 2 142740917 missense probably damaging 1.00
R2401:Kif16b UTSW 2 142756122 missense probably benign 0.04
R3951:Kif16b UTSW 2 142707359 missense probably benign 0.01
R4161:Kif16b UTSW 2 142707404 missense probably benign 0.00
R4697:Kif16b UTSW 2 142690694 missense probably benign 0.09
R4747:Kif16b UTSW 2 142857426 missense probably damaging 1.00
R4808:Kif16b UTSW 2 142857358 missense probably damaging 1.00
R4878:Kif16b UTSW 2 142848003 missense probably damaging 1.00
R5068:Kif16b UTSW 2 142711707 missense probably benign
R5120:Kif16b UTSW 2 142848339 missense probably damaging 1.00
R5358:Kif16b UTSW 2 142740969 missense probably damaging 1.00
R5821:Kif16b UTSW 2 142702666 missense probably damaging 1.00
R5833:Kif16b UTSW 2 142707367 missense probably benign
R5882:Kif16b UTSW 2 142707258 critical splice donor site probably null
R5974:Kif16b UTSW 2 142857381 missense probably damaging 1.00
R6043:Kif16b UTSW 2 142711900 missense probably damaging 1.00
R6230:Kif16b UTSW 2 142849912 missense probably damaging 1.00
R6373:Kif16b UTSW 2 142699698 missense possibly damaging 0.91
R6472:Kif16b UTSW 2 142699948 intron probably benign
R6622:Kif16b UTSW 2 142712442 missense probably benign 0.01
R6654:Kif16b UTSW 2 142701277 intron probably benign
R6912:Kif16b UTSW 2 142700099 intron probably benign
R7003:Kif16b UTSW 2 142758829 missense possibly damaging 0.95
R7265:Kif16b UTSW 2 142714730 missense probably damaging 1.00
R7307:Kif16b UTSW 2 142712931 missense probably benign 0.00
R7376:Kif16b UTSW 2 142711872 missense probably damaging 0.99
R7381:Kif16b UTSW 2 142857423 missense probably damaging 1.00
R7558:Kif16b UTSW 2 142758826 missense probably damaging 1.00
R7681:Kif16b UTSW 2 142756126 missense probably damaging 1.00
R7896:Kif16b UTSW 2 142834075 critical splice donor site probably null
R7956:Kif16b UTSW 2 142862470 missense probably benign 0.00
R8053:Kif16b UTSW 2 142853714 missense probably damaging 1.00
R8056:Kif16b UTSW 2 142712842 missense probably damaging 1.00
R8139:Kif16b UTSW 2 142901365 missense probably benign 0.00
R8182:Kif16b UTSW 2 142712899 missense possibly damaging 0.90
R8224:Kif16b UTSW 2 142834088 missense probably benign 0.03
R8357:Kif16b UTSW 2 142711908 missense probably damaging 1.00
R8360:Kif16b UTSW 2 142711857 missense probably benign 0.05
R8369:Kif16b UTSW 2 142711857 missense probably benign 0.05
R8385:Kif16b UTSW 2 142712338 missense probably benign 0.09
R8457:Kif16b UTSW 2 142711908 missense probably damaging 1.00
X0058:Kif16b UTSW 2 142758861 missense probably damaging 1.00
Z1177:Kif16b UTSW 2 142711824 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTTACCTTGCAGGGTCCATC -3'
(R):5'- TTGATGCCCTTGACAGTGG -3'

Sequencing Primer
(F):5'- TTGCAGGGTCCATCTCAAG -3'
(R):5'- AGTGGTGTCCTAGGCCTAGAC -3'
Posted On2020-09-02