Incidental Mutation 'R8359:Ppp1r16b'
ID645901
Institutional Source Beutler Lab
Gene Symbol Ppp1r16b
Ensembl Gene ENSMUSG00000037754
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 16B
SynonymsC130078N17Rik, Wdt4, ANKRD4
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8359 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location158665398-158766334 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 158761375 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 407 (V407L)
Ref Sequence ENSEMBL: ENSMUSP00000039540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045503] [ENSMUST00000052927] [ENSMUST00000103116] [ENSMUST00000145073]
Predicted Effect probably benign
Transcript: ENSMUST00000045503
AA Change: V407L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039540
Gene: ENSMUSG00000037754
AA Change: V407L

DomainStartEndE-ValueType
low complexity region 22 39 N/A INTRINSIC
low complexity region 46 55 N/A INTRINSIC
ANK 67 96 5.69e2 SMART
ANK 100 129 5.04e-6 SMART
ANK 133 162 1.76e-5 SMART
ANK 228 257 4.43e-2 SMART
ANK 261 290 1.38e-3 SMART
low complexity region 301 314 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 504 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000052927
AA Change: V407L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000062615
Gene: ENSMUSG00000037754
AA Change: V407L

DomainStartEndE-ValueType
low complexity region 22 39 N/A INTRINSIC
low complexity region 46 55 N/A INTRINSIC
ANK 67 96 5.69e2 SMART
ANK 100 129 5.04e-6 SMART
ANK 133 162 1.76e-5 SMART
ANK 228 257 4.43e-2 SMART
ANK 261 290 1.38e-3 SMART
low complexity region 301 314 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 504 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103116
AA Change: V407L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099405
Gene: ENSMUSG00000037754
AA Change: V407L

DomainStartEndE-ValueType
low complexity region 22 39 N/A INTRINSIC
low complexity region 46 55 N/A INTRINSIC
ANK 67 96 5.69e2 SMART
ANK 100 129 5.04e-6 SMART
ANK 133 162 1.76e-5 SMART
ANK 228 257 4.43e-2 SMART
ANK 261 290 1.38e-3 SMART
low complexity region 301 314 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 504 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145073
AA Change: V307L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117310
Gene: ENSMUSG00000037754
AA Change: V307L

DomainStartEndE-ValueType
ANK 9 38 5.69e2 SMART
ANK 42 71 5.04e-6 SMART
ANK 75 104 1.76e-5 SMART
Blast:ANK 149 190 5e-18 BLAST
low complexity region 201 214 N/A INTRINSIC
low complexity region 227 242 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is membrane-associated and contains five ankyrin repeats, a protein phosphatase-1-interacting domain, and a carboxy-terminal CAAX box domain. Synthesis of the encoded protein is inhibited by transforming growth factor beta-1. The protein may bind to the membrane through its CAAX box domain and may act as a signaling molecule through interaction with protein phosphatase-1. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and grossly normal with no detectable defects in thymopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A T 8: 24,806,486 V315D probably damaging Het
Adgrf1 A T 17: 43,310,395 I508F probably damaging Het
Atpaf2 T C 11: 60,407,303 D147G probably damaging Het
Brwd1 T C 16: 96,016,209 T1368A probably damaging Het
Cacna1s A T 1: 136,116,061 E1626V probably benign Het
Carm1 G A 9: 21,569,469 V80I possibly damaging Het
Casc4 A T 2: 121,867,151 probably benign Het
Cenpw T A 10: 30,198,488 D71V probably damaging Het
Ckmt1 A T 2: 121,363,050 T364S probably benign Het
Col6a4 T C 9: 106,068,384 S844G probably benign Het
Crybg1 T C 10: 43,992,542 E1380G probably benign Het
Cyp21a1 A G 17: 34,802,131 probably null Het
D430042O09Rik T C 7: 125,868,851 probably null Het
Dhodh A C 8: 109,606,406 D12E probably benign Het
Dnali1 T A 4: 125,063,667 T95S probably damaging Het
Dynlrb1 A G 2: 155,249,950 N93D probably benign Het
Edem1 C T 6: 108,846,813 A390V probably benign Het
Enthd1 T C 15: 80,474,155 D388G probably benign Het
Fam170a A G 18: 50,281,610 T108A probably damaging Het
Fryl A G 5: 73,075,933 S1531P probably benign Het
Hspbap1 C A 16: 35,824,996 N350K probably benign Het
Htr3b A C 9: 48,947,296 S94R probably damaging Het
Ide A T 19: 37,330,487 V42E Het
Igf2r A G 17: 12,683,861 V2434A probably benign Het
Kif16b G A 2: 142,711,857 A1007V probably benign Het
Mccc1 C T 3: 35,964,344 V614I probably benign Het
Mos A G 4: 3,871,097 Y240H probably damaging Het
Myh11 C T 16: 14,208,231 probably null Het
Nexn T A 3: 152,248,361 D166V probably damaging Het
Olfr328 G T 11: 58,552,203 T12N probably benign Het
Olfr510 T A 7: 108,668,311 N298K probably benign Het
Olfr55 G A 17: 33,176,921 C173Y probably damaging Het
Pkp4 A G 2: 59,350,551 Y1061C probably damaging Het
Pla2g6 T C 15: 79,287,170 D740G probably damaging Het
Pla2r1 T A 2: 60,443,283 I920L probably benign Het
Plekha2 A G 8: 25,088,391 I31T probably damaging Het
Prss50 A G 9: 110,862,302 I225V probably damaging Het
Rmdn2 A T 17: 79,628,151 E231V Het
Sema3c T C 5: 17,653,728 S42P possibly damaging Het
Slc22a20 T C 19: 5,971,526 I483V probably benign Het
Slc30a2 T C 4: 134,349,379 V275A probably damaging Het
Slc6a3 T A 13: 73,544,883 F207L probably benign Het
Slc9a1 A T 4: 133,420,616 Q648H probably damaging Het
Slpi A T 2: 164,356,055 M1K probably null Het
Smc5 A C 19: 23,234,079 S564A possibly damaging Het
Smchd1 A T 17: 71,431,243 F542L probably damaging Het
Sycp1 T A 3: 102,820,593 K901N probably damaging Het
Synpo2l T A 14: 20,666,140 T126S probably benign Het
Upp2 A G 2: 58,777,943 N216S probably benign Het
Wnk1 T C 6: 119,992,447 D349G probably damaging Het
Zfp180 C T 7: 24,104,912 A252V probably benign Het
Zfr2 C T 10: 81,242,819 T295I possibly damaging Het
Zkscan16 C T 4: 58,957,230 T504I possibly damaging Het
Other mutations in Ppp1r16b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Ppp1r16b APN 2 158756965 missense probably damaging 1.00
IGL01024:Ppp1r16b APN 2 158740816 splice site probably benign
IGL01080:Ppp1r16b APN 2 158757172 missense probably damaging 0.99
IGL02106:Ppp1r16b APN 2 158746531 missense possibly damaging 0.51
IGL03084:Ppp1r16b APN 2 158761493 nonsense probably null
R0037:Ppp1r16b UTSW 2 158757209 missense probably damaging 0.98
R0037:Ppp1r16b UTSW 2 158757209 missense probably damaging 0.98
R0190:Ppp1r16b UTSW 2 158696063 missense probably damaging 1.00
R0294:Ppp1r16b UTSW 2 158746603 missense probably damaging 1.00
R1735:Ppp1r16b UTSW 2 158761495 missense possibly damaging 0.94
R1746:Ppp1r16b UTSW 2 158746665 critical splice donor site probably null
R1847:Ppp1r16b UTSW 2 158761435 missense probably damaging 0.99
R2297:Ppp1r16b UTSW 2 158761366 missense possibly damaging 0.88
R2509:Ppp1r16b UTSW 2 158761463 missense possibly damaging 0.87
R2923:Ppp1r16b UTSW 2 158756957 missense probably damaging 1.00
R3907:Ppp1r16b UTSW 2 158761490 missense probably benign 0.00
R4344:Ppp1r16b UTSW 2 158749186 missense probably damaging 1.00
R4373:Ppp1r16b UTSW 2 158761765 missense probably damaging 1.00
R4423:Ppp1r16b UTSW 2 158757254 missense probably benign 0.00
R4424:Ppp1r16b UTSW 2 158757254 missense probably benign 0.00
R4425:Ppp1r16b UTSW 2 158757254 missense probably benign 0.00
R4623:Ppp1r16b UTSW 2 158761463 missense possibly damaging 0.87
R5436:Ppp1r16b UTSW 2 158757333 intron probably benign
R6029:Ppp1r16b UTSW 2 158755217 missense possibly damaging 0.74
R6119:Ppp1r16b UTSW 2 158751127 missense probably benign 0.00
R6816:Ppp1r16b UTSW 2 158761675 missense probably benign 0.00
R6941:Ppp1r16b UTSW 2 158696148 missense probably damaging 1.00
R7048:Ppp1r16b UTSW 2 158757254 missense probably benign 0.00
R7101:Ppp1r16b UTSW 2 158761763 missense probably damaging 1.00
R7255:Ppp1r16b UTSW 2 158761391 missense probably benign 0.41
R7490:Ppp1r16b UTSW 2 158761468 missense probably damaging 0.99
R8300:Ppp1r16b UTSW 2 158746651 missense probably damaging 0.98
X0064:Ppp1r16b UTSW 2 158751127 missense probably benign 0.00
Z1177:Ppp1r16b UTSW 2 158761434 missense probably benign 0.18
Z1177:Ppp1r16b UTSW 2 158761814 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGCCCTACCATACAGAGC -3'
(R):5'- ATGGGTGACTGAGCAGCTTG -3'

Sequencing Primer
(F):5'- TACCATACAGAGCCTGGTGC -3'
(R):5'- TTGAAGCCACTCCAGGGTG -3'
Posted On2020-09-02