Incidental Mutation 'R8359:Zkscan16'
ID645907
Institutional Source Beutler Lab
Gene Symbol Zkscan16
Ensembl Gene ENSMUSG00000038630
Gene Namezinc finger with KRAB and SCAN domains 16
SynonymsZfp483
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R8359 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location58943628-58958355 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 58957230 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 504 (T504I)
Ref Sequence ENSEMBL: ENSMUSP00000103178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107554]
Predicted Effect possibly damaging
Transcript: ENSMUST00000107554
AA Change: T504I

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103178
Gene: ENSMUSG00000038630
AA Change: T504I

DomainStartEndE-ValueType
SCAN 44 153 1.9e-42 SMART
KRAB 170 230 1.66e-20 SMART
internal_repeat_1 281 452 7.49e-5 PROSPERO
ZnF_C2H2 483 505 4.79e-3 SMART
ZnF_C2H2 511 533 2.75e-3 SMART
ZnF_C2H2 539 561 1.6e-4 SMART
ZnF_C2H2 567 589 5.99e-4 SMART
ZnF_C2H2 595 617 1.99e0 SMART
ZnF_C2H2 623 645 5.14e-3 SMART
ZnF_C2H2 651 673 2.65e-5 SMART
ZnF_C2H2 679 701 1.82e-3 SMART
ZnF_C2H2 706 725 4.74e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A T 8: 24,806,486 V315D probably damaging Het
Adgrf1 A T 17: 43,310,395 I508F probably damaging Het
Atpaf2 T C 11: 60,407,303 D147G probably damaging Het
Brwd1 T C 16: 96,016,209 T1368A probably damaging Het
Cacna1s A T 1: 136,116,061 E1626V probably benign Het
Carm1 G A 9: 21,569,469 V80I possibly damaging Het
Casc4 A T 2: 121,867,151 probably benign Het
Cenpw T A 10: 30,198,488 D71V probably damaging Het
Ckmt1 A T 2: 121,363,050 T364S probably benign Het
Col6a4 T C 9: 106,068,384 S844G probably benign Het
Crybg1 T C 10: 43,992,542 E1380G probably benign Het
Cyp21a1 A G 17: 34,802,131 probably null Het
D430042O09Rik T C 7: 125,868,851 probably null Het
Dhodh A C 8: 109,606,406 D12E probably benign Het
Dnali1 T A 4: 125,063,667 T95S probably damaging Het
Dynlrb1 A G 2: 155,249,950 N93D probably benign Het
Edem1 C T 6: 108,846,813 A390V probably benign Het
Enthd1 T C 15: 80,474,155 D388G probably benign Het
Fam170a A G 18: 50,281,610 T108A probably damaging Het
Fryl A G 5: 73,075,933 S1531P probably benign Het
Hspbap1 C A 16: 35,824,996 N350K probably benign Het
Htr3b A C 9: 48,947,296 S94R probably damaging Het
Ide A T 19: 37,330,487 V42E Het
Igf2r A G 17: 12,683,861 V2434A probably benign Het
Kif16b G A 2: 142,711,857 A1007V probably benign Het
Mccc1 C T 3: 35,964,344 V614I probably benign Het
Mos A G 4: 3,871,097 Y240H probably damaging Het
Myh11 C T 16: 14,208,231 probably null Het
Nexn T A 3: 152,248,361 D166V probably damaging Het
Olfr328 G T 11: 58,552,203 T12N probably benign Het
Olfr510 T A 7: 108,668,311 N298K probably benign Het
Olfr55 G A 17: 33,176,921 C173Y probably damaging Het
Pkp4 A G 2: 59,350,551 Y1061C probably damaging Het
Pla2g6 T C 15: 79,287,170 D740G probably damaging Het
Pla2r1 T A 2: 60,443,283 I920L probably benign Het
Plekha2 A G 8: 25,088,391 I31T probably damaging Het
Ppp1r16b G T 2: 158,761,375 V407L probably benign Het
Prss50 A G 9: 110,862,302 I225V probably damaging Het
Rmdn2 A T 17: 79,628,151 E231V Het
Sema3c T C 5: 17,653,728 S42P possibly damaging Het
Slc22a20 T C 19: 5,971,526 I483V probably benign Het
Slc30a2 T C 4: 134,349,379 V275A probably damaging Het
Slc6a3 T A 13: 73,544,883 F207L probably benign Het
Slc9a1 A T 4: 133,420,616 Q648H probably damaging Het
Slpi A T 2: 164,356,055 M1K probably null Het
Smc5 A C 19: 23,234,079 S564A possibly damaging Het
Smchd1 A T 17: 71,431,243 F542L probably damaging Het
Sycp1 T A 3: 102,820,593 K901N probably damaging Het
Synpo2l T A 14: 20,666,140 T126S probably benign Het
Upp2 A G 2: 58,777,943 N216S probably benign Het
Wnk1 T C 6: 119,992,447 D349G probably damaging Het
Zfp180 C T 7: 24,104,912 A252V probably benign Het
Zfr2 C T 10: 81,242,819 T295I possibly damaging Het
Other mutations in Zkscan16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Zkscan16 APN 4 58957709 missense possibly damaging 0.86
IGL01296:Zkscan16 APN 4 58956690 missense possibly damaging 0.53
IGL01330:Zkscan16 APN 4 58956483 missense possibly damaging 0.85
IGL02143:Zkscan16 APN 4 58956911 missense probably damaging 1.00
IGL02901:Zkscan16 APN 4 58946283 missense probably damaging 0.98
IGL03399:Zkscan16 APN 4 58956915 missense probably benign 0.33
R0271:Zkscan16 UTSW 4 58952391 missense probably benign 0.33
R0317:Zkscan16 UTSW 4 58957602 missense possibly damaging 0.86
R0542:Zkscan16 UTSW 4 58956597 missense possibly damaging 0.53
R1417:Zkscan16 UTSW 4 58952377 missense probably benign 0.33
R1674:Zkscan16 UTSW 4 58948918 missense possibly damaging 0.96
R2014:Zkscan16 UTSW 4 58956525 missense possibly damaging 0.96
R2246:Zkscan16 UTSW 4 58957329 missense probably benign 0.09
R2352:Zkscan16 UTSW 4 58951869 missense possibly damaging 0.71
R2851:Zkscan16 UTSW 4 58957364 missense possibly damaging 0.71
R2852:Zkscan16 UTSW 4 58957364 missense possibly damaging 0.71
R3896:Zkscan16 UTSW 4 58946125 start gained probably benign
R4488:Zkscan16 UTSW 4 58957431 missense possibly damaging 0.89
R4631:Zkscan16 UTSW 4 58951918 missense probably damaging 0.98
R4825:Zkscan16 UTSW 4 58957809 missense possibly damaging 0.73
R4912:Zkscan16 UTSW 4 58946506 missense possibly damaging 0.85
R5014:Zkscan16 UTSW 4 58951892 missense probably damaging 0.97
R5411:Zkscan16 UTSW 4 58956745 frame shift probably null
R5642:Zkscan16 UTSW 4 58957748 missense probably benign 0.11
R5809:Zkscan16 UTSW 4 58946481 missense probably damaging 0.98
R6089:Zkscan16 UTSW 4 58948889 missense possibly damaging 0.85
R6152:Zkscan16 UTSW 4 58946260 missense possibly damaging 0.85
R6469:Zkscan16 UTSW 4 58956483 missense probably damaging 0.98
R7662:Zkscan16 UTSW 4 58957679 nonsense probably null
R7790:Zkscan16 UTSW 4 58951843 nonsense probably null
R8150:Zkscan16 UTSW 4 58952407 missense probably benign 0.06
X0020:Zkscan16 UTSW 4 58956747 missense possibly damaging 0.91
Z1176:Zkscan16 UTSW 4 58957052 missense probably damaging 1.00
Z1177:Zkscan16 UTSW 4 58948909 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TTTGAGCCTGGTACGAAGCG -3'
(R):5'- GGAAAGACAGTCCACAGTCCTTAC -3'

Sequencing Primer
(F):5'- TACGAAGCGCTCCGTGTGTC -3'
(R):5'- GCACTCGTTACACTTATAGGGC -3'
Posted On2020-09-02