Incidental Mutation 'R8359:Slc30a2'
ID645910
Institutional Source Beutler Lab
Gene Symbol Slc30a2
Ensembl Gene ENSMUSG00000028836
Gene Namesolute carrier family 30 (zinc transporter), member 2
SynonymsZnt2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R8359 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location134343181-134354484 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 134349379 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 275 (V275A)
Ref Sequence ENSEMBL: ENSMUSP00000101500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081094] [ENSMUST00000105872] [ENSMUST00000105873] [ENSMUST00000105874]
Predicted Effect probably damaging
Transcript: ENSMUST00000081094
AA Change: V195A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079875
Gene: ENSMUSG00000028836
AA Change: V195A

DomainStartEndE-ValueType
Pfam:Cation_efflux 1 280 6e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105872
AA Change: V195A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101498
Gene: ENSMUSG00000028836
AA Change: V195A

DomainStartEndE-ValueType
Pfam:Cation_efflux 1 280 6e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105873
AA Change: V226A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101499
Gene: ENSMUSG00000028836
AA Change: V226A

DomainStartEndE-ValueType
Pfam:Cation_efflux 74 311 3.1e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105874
AA Change: V275A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101500
Gene: ENSMUSG00000028836
AA Change: V275A

DomainStartEndE-ValueType
Pfam:Cation_efflux 70 277 3.4e-51 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc transporter that acts as a homodimer. The encoded protein plays a role in secreting zinc into breast milk. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A T 8: 24,806,486 V315D probably damaging Het
Adgrf1 A T 17: 43,310,395 I508F probably damaging Het
Atpaf2 T C 11: 60,407,303 D147G probably damaging Het
Brwd1 T C 16: 96,016,209 T1368A probably damaging Het
Cacna1s A T 1: 136,116,061 E1626V probably benign Het
Carm1 G A 9: 21,569,469 V80I possibly damaging Het
Casc4 A T 2: 121,867,151 probably benign Het
Cenpw T A 10: 30,198,488 D71V probably damaging Het
Ckmt1 A T 2: 121,363,050 T364S probably benign Het
Col6a4 T C 9: 106,068,384 S844G probably benign Het
Crybg1 T C 10: 43,992,542 E1380G probably benign Het
Cyp21a1 A G 17: 34,802,131 probably null Het
D430042O09Rik T C 7: 125,868,851 probably null Het
Dhodh A C 8: 109,606,406 D12E probably benign Het
Dnali1 T A 4: 125,063,667 T95S probably damaging Het
Dynlrb1 A G 2: 155,249,950 N93D probably benign Het
Edem1 C T 6: 108,846,813 A390V probably benign Het
Enthd1 T C 15: 80,474,155 D388G probably benign Het
Fam170a A G 18: 50,281,610 T108A probably damaging Het
Fryl A G 5: 73,075,933 S1531P probably benign Het
Hspbap1 C A 16: 35,824,996 N350K probably benign Het
Htr3b A C 9: 48,947,296 S94R probably damaging Het
Ide A T 19: 37,330,487 V42E Het
Igf2r A G 17: 12,683,861 V2434A probably benign Het
Kif16b G A 2: 142,711,857 A1007V probably benign Het
Mccc1 C T 3: 35,964,344 V614I probably benign Het
Mos A G 4: 3,871,097 Y240H probably damaging Het
Myh11 C T 16: 14,208,231 probably null Het
Nexn T A 3: 152,248,361 D166V probably damaging Het
Olfr328 G T 11: 58,552,203 T12N probably benign Het
Olfr510 T A 7: 108,668,311 N298K probably benign Het
Olfr55 G A 17: 33,176,921 C173Y probably damaging Het
Pkp4 A G 2: 59,350,551 Y1061C probably damaging Het
Pla2g6 T C 15: 79,287,170 D740G probably damaging Het
Pla2r1 T A 2: 60,443,283 I920L probably benign Het
Plekha2 A G 8: 25,088,391 I31T probably damaging Het
Ppp1r16b G T 2: 158,761,375 V407L probably benign Het
Prss50 A G 9: 110,862,302 I225V probably damaging Het
Rmdn2 A T 17: 79,628,151 E231V Het
Sema3c T C 5: 17,653,728 S42P possibly damaging Het
Slc22a20 T C 19: 5,971,526 I483V probably benign Het
Slc6a3 T A 13: 73,544,883 F207L probably benign Het
Slc9a1 A T 4: 133,420,616 Q648H probably damaging Het
Slpi A T 2: 164,356,055 M1K probably null Het
Smc5 A C 19: 23,234,079 S564A possibly damaging Het
Smchd1 A T 17: 71,431,243 F542L probably damaging Het
Sycp1 T A 3: 102,820,593 K901N probably damaging Het
Synpo2l T A 14: 20,666,140 T126S probably benign Het
Upp2 A G 2: 58,777,943 N216S probably benign Het
Wnk1 T C 6: 119,992,447 D349G probably damaging Het
Zfp180 C T 7: 24,104,912 A252V probably benign Het
Zfr2 C T 10: 81,242,819 T295I possibly damaging Het
Zkscan16 C T 4: 58,957,230 T504I possibly damaging Het
Other mutations in Slc30a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01321:Slc30a2 APN 4 134343300 missense probably damaging 0.96
IGL01822:Slc30a2 APN 4 134348637 missense probably damaging 0.98
IGL02808:Slc30a2 APN 4 134344049 missense possibly damaging 0.65
R1415:Slc30a2 UTSW 4 134349349 missense probably damaging 1.00
R2279:Slc30a2 UTSW 4 134348546 missense probably benign
R4151:Slc30a2 UTSW 4 134344048 missense probably benign 0.00
R4278:Slc30a2 UTSW 4 134346049 missense probably null 1.00
R4783:Slc30a2 UTSW 4 134344006 critical splice acceptor site probably null
R5823:Slc30a2 UTSW 4 134345978 missense probably damaging 0.98
R7017:Slc30a2 UTSW 4 134347415 missense probably damaging 1.00
R7018:Slc30a2 UTSW 4 134347415 missense probably damaging 1.00
R7021:Slc30a2 UTSW 4 134347415 missense probably damaging 1.00
R7034:Slc30a2 UTSW 4 134347342 missense possibly damaging 0.80
R7053:Slc30a2 UTSW 4 134347415 missense probably damaging 1.00
R7056:Slc30a2 UTSW 4 134347415 missense probably damaging 1.00
R7057:Slc30a2 UTSW 4 134347415 missense probably damaging 1.00
R7067:Slc30a2 UTSW 4 134344218 critical splice donor site probably null
R7138:Slc30a2 UTSW 4 134344118 missense probably benign 0.00
R7275:Slc30a2 UTSW 4 134349270 splice site probably null
R7289:Slc30a2 UTSW 4 134344213 missense possibly damaging 0.69
R8015:Slc30a2 UTSW 4 134347450 missense probably benign 0.01
Z1176:Slc30a2 UTSW 4 134344089 missense probably benign 0.00
Z1177:Slc30a2 UTSW 4 134347455 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCCTGATACAGTGTTCCTGG -3'
(R):5'- CCAAAGCTACACAGTGGGAC -3'

Sequencing Primer
(F):5'- TACAGTGTTCCTGGGAGGGAAG -3'
(R):5'- TGGGACCCTGGCTCAGAAAC -3'
Posted On2020-09-02