Incidental Mutation 'R8359:D430042O09Rik'
ID645917
Institutional Source Beutler Lab
Gene Symbol D430042O09Rik
Ensembl Gene ENSMUSG00000032743
Gene NameRIKEN cDNA D430042O09 gene
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8359 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location125707888-125874793 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 125868851 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000065744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069660] [ENSMUST00000124223]
Predicted Effect probably null
Transcript: ENSMUST00000069660
SMART Domains Protein: ENSMUSP00000065744
Gene: ENSMUSG00000032743

DomainStartEndE-ValueType
internal_repeat_3 442 586 9.64e-5 PROSPERO
internal_repeat_2 454 607 1.91e-6 PROSPERO
low complexity region 704 718 N/A INTRINSIC
Pfam:DUF4457 909 1099 5.1e-43 PFAM
Pfam:DUF4457 1205 1524 8.4e-149 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000124223
SMART Domains Protein: ENSMUSP00000118668
Gene: ENSMUSG00000032743

DomainStartEndE-ValueType
internal_repeat_3 416 560 8.9e-5 PROSPERO
internal_repeat_2 428 581 1.74e-6 PROSPERO
low complexity region 678 692 N/A INTRINSIC
Pfam:DUF4457 882 1073 1.4e-39 PFAM
Pfam:DUF4457 1179 1498 2.2e-145 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132204
SMART Domains Protein: ENSMUSP00000115955
Gene: ENSMUSG00000032743

DomainStartEndE-ValueType
Pfam:DUF4457 1 143 3.6e-51 PFAM
Pfam:DUF4457 139 219 2.4e-41 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a novel, evolutionarily conserved, ciliary protein. In human hTERT-RPE1 cells, the protein is found at the base of cilia, decorating the ciliary axoneme, and enriched at the ciliary tip. The protein binds to microtubules in vitro and regulates their stability when it is overexpressed. A null mutation in this gene has been associated with Joubert syndrome, a recessive disorder that is characterized by a distinctive mid-hindbrain and cerebellar malformation and is also often associated with wider ciliopathy symptoms. Consistently, in a serum-starvation ciliogenesis assay, human fibroblast cells derived from patients with the mutation display a reduced number of ciliated cells with abnormally long cilia. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit variable obstructive hydrocephaly and enlarged lateral ventricles resulting from a blockage of cerebrospinal fluid flow in the cerebral aqueduct but show no gross defects in ventricular ependymal cilium structure or motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A T 8: 24,806,486 V315D probably damaging Het
Adgrf1 A T 17: 43,310,395 I508F probably damaging Het
Atpaf2 T C 11: 60,407,303 D147G probably damaging Het
Brwd1 T C 16: 96,016,209 T1368A probably damaging Het
Cacna1s A T 1: 136,116,061 E1626V probably benign Het
Carm1 G A 9: 21,569,469 V80I possibly damaging Het
Casc4 A T 2: 121,867,151 probably benign Het
Cenpw T A 10: 30,198,488 D71V probably damaging Het
Ckmt1 A T 2: 121,363,050 T364S probably benign Het
Col6a4 T C 9: 106,068,384 S844G probably benign Het
Crybg1 T C 10: 43,992,542 E1380G probably benign Het
Cyp21a1 A G 17: 34,802,131 probably null Het
Dhodh A C 8: 109,606,406 D12E probably benign Het
Dnali1 T A 4: 125,063,667 T95S probably damaging Het
Dynlrb1 A G 2: 155,249,950 N93D probably benign Het
Edem1 C T 6: 108,846,813 A390V probably benign Het
Enthd1 T C 15: 80,474,155 D388G probably benign Het
Fam170a A G 18: 50,281,610 T108A probably damaging Het
Fryl A G 5: 73,075,933 S1531P probably benign Het
Hspbap1 C A 16: 35,824,996 N350K probably benign Het
Htr3b A C 9: 48,947,296 S94R probably damaging Het
Ide A T 19: 37,330,487 V42E Het
Igf2r A G 17: 12,683,861 V2434A probably benign Het
Kif16b G A 2: 142,711,857 A1007V probably benign Het
Mccc1 C T 3: 35,964,344 V614I probably benign Het
Mos A G 4: 3,871,097 Y240H probably damaging Het
Myh11 C T 16: 14,208,231 probably null Het
Nexn T A 3: 152,248,361 D166V probably damaging Het
Olfr328 G T 11: 58,552,203 T12N probably benign Het
Olfr510 T A 7: 108,668,311 N298K probably benign Het
Olfr55 G A 17: 33,176,921 C173Y probably damaging Het
Pkp4 A G 2: 59,350,551 Y1061C probably damaging Het
Pla2g6 T C 15: 79,287,170 D740G probably damaging Het
Pla2r1 T A 2: 60,443,283 I920L probably benign Het
Plekha2 A G 8: 25,088,391 I31T probably damaging Het
Ppp1r16b G T 2: 158,761,375 V407L probably benign Het
Prss50 A G 9: 110,862,302 I225V probably damaging Het
Rmdn2 A T 17: 79,628,151 E231V Het
Sema3c T C 5: 17,653,728 S42P possibly damaging Het
Slc22a20 T C 19: 5,971,526 I483V probably benign Het
Slc30a2 T C 4: 134,349,379 V275A probably damaging Het
Slc6a3 T A 13: 73,544,883 F207L probably benign Het
Slc9a1 A T 4: 133,420,616 Q648H probably damaging Het
Slpi A T 2: 164,356,055 M1K probably null Het
Smc5 A C 19: 23,234,079 S564A possibly damaging Het
Smchd1 A T 17: 71,431,243 F542L probably damaging Het
Sycp1 T A 3: 102,820,593 K901N probably damaging Het
Synpo2l T A 14: 20,666,140 T126S probably benign Het
Upp2 A G 2: 58,777,943 N216S probably benign Het
Wnk1 T C 6: 119,992,447 D349G probably damaging Het
Zfp180 C T 7: 24,104,912 A252V probably benign Het
Zfr2 C T 10: 81,242,819 T295I possibly damaging Het
Zkscan16 C T 4: 58,957,230 T504I possibly damaging Het
Other mutations in D430042O09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00697:D430042O09Rik APN 7 125795450 missense possibly damaging 0.75
IGL00950:D430042O09Rik APN 7 125843221 missense probably benign
IGL01089:D430042O09Rik APN 7 125795313 missense probably damaging 1.00
IGL01099:D430042O09Rik APN 7 125865320 missense probably damaging 1.00
IGL01449:D430042O09Rik APN 7 125870685 missense probably damaging 1.00
IGL01545:D430042O09Rik APN 7 125752971 critical splice acceptor site probably null
IGL01937:D430042O09Rik APN 7 125854605 missense probably benign 0.13
IGL01949:D430042O09Rik APN 7 125761842 nonsense probably null
IGL02096:D430042O09Rik APN 7 125814821 missense probably benign 0.09
IGL02148:D430042O09Rik APN 7 125873476 splice site probably null
IGL02274:D430042O09Rik APN 7 125770570 critical splice acceptor site probably null
IGL02323:D430042O09Rik APN 7 125842829 missense probably benign 0.04
IGL02574:D430042O09Rik APN 7 125829753 missense possibly damaging 0.48
IGL02639:D430042O09Rik APN 7 125872792 missense probably damaging 1.00
IGL02833:D430042O09Rik APN 7 125850412 nonsense probably null
IGL03003:D430042O09Rik APN 7 125851960 missense probably damaging 1.00
IGL03011:D430042O09Rik APN 7 125852002 missense probably benign 0.01
IGL03332:D430042O09Rik APN 7 125820105 nonsense probably null
IGL03368:D430042O09Rik APN 7 125868858 intron probably benign
E0370:D430042O09Rik UTSW 7 125850302 missense probably benign 0.06
PIT4498001:D430042O09Rik UTSW 7 125813596 missense probably benign
R0033:D430042O09Rik UTSW 7 125761827 missense possibly damaging 0.77
R0033:D430042O09Rik UTSW 7 125761827 missense possibly damaging 0.77
R0234:D430042O09Rik UTSW 7 125795385 missense probably benign 0.00
R0234:D430042O09Rik UTSW 7 125795385 missense probably benign 0.00
R0472:D430042O09Rik UTSW 7 125872967 missense probably damaging 0.98
R0479:D430042O09Rik UTSW 7 125843346 missense probably benign 0.20
R1195:D430042O09Rik UTSW 7 125866482 missense probably damaging 1.00
R1195:D430042O09Rik UTSW 7 125866482 missense probably damaging 1.00
R1195:D430042O09Rik UTSW 7 125866482 missense probably damaging 1.00
R1223:D430042O09Rik UTSW 7 125760423 missense possibly damaging 0.75
R1299:D430042O09Rik UTSW 7 125852023 missense probably benign
R1331:D430042O09Rik UTSW 7 125866455 missense probably benign 0.00
R1484:D430042O09Rik UTSW 7 125816571 splice site probably benign
R1507:D430042O09Rik UTSW 7 125866352 missense probably damaging 1.00
R1562:D430042O09Rik UTSW 7 125842848 missense probably damaging 1.00
R1992:D430042O09Rik UTSW 7 125820089 missense probably benign 0.00
R2008:D430042O09Rik UTSW 7 125860566 missense probably damaging 1.00
R2010:D430042O09Rik UTSW 7 125872956 missense possibly damaging 0.93
R2147:D430042O09Rik UTSW 7 125865320 missense probably damaging 1.00
R2508:D430042O09Rik UTSW 7 125795343 missense probably benign
R3015:D430042O09Rik UTSW 7 125866340 missense probably damaging 1.00
R3794:D430042O09Rik UTSW 7 125820089 missense probably benign 0.00
R3795:D430042O09Rik UTSW 7 125820089 missense probably benign 0.00
R4043:D430042O09Rik UTSW 7 125868741 missense probably benign 0.30
R4044:D430042O09Rik UTSW 7 125868741 missense probably benign 0.30
R4692:D430042O09Rik UTSW 7 125867669 critical splice donor site probably null
R4772:D430042O09Rik UTSW 7 125865351 missense probably damaging 0.96
R5155:D430042O09Rik UTSW 7 125872184 missense probably damaging 1.00
R5467:D430042O09Rik UTSW 7 125843355 missense possibly damaging 0.65
R5551:D430042O09Rik UTSW 7 125820077 missense probably damaging 1.00
R5560:D430042O09Rik UTSW 7 125854561 missense probably benign 0.00
R5662:D430042O09Rik UTSW 7 125842703 missense probably benign 0.00
R5667:D430042O09Rik UTSW 7 125843455 critical splice donor site probably null
R5838:D430042O09Rik UTSW 7 125867655 missense possibly damaging 0.88
R5958:D430042O09Rik UTSW 7 125813635 missense probably benign 0.01
R5983:D430042O09Rik UTSW 7 125850373 missense probably damaging 1.00
R6084:D430042O09Rik UTSW 7 125814865 missense probably benign
R6241:D430042O09Rik UTSW 7 125872834 missense probably benign 0.00
R6298:D430042O09Rik UTSW 7 125870697 missense probably benign 0.11
R6345:D430042O09Rik UTSW 7 125752987 missense probably damaging 0.97
R6554:D430042O09Rik UTSW 7 125850742 missense probably damaging 1.00
R6715:D430042O09Rik UTSW 7 125761829 nonsense probably null
R6745:D430042O09Rik UTSW 7 125770650 missense probably benign 0.00
R7178:D430042O09Rik UTSW 7 125866327 missense probably benign 0.00
R7210:D430042O09Rik UTSW 7 125872239 missense probably damaging 1.00
R7404:D430042O09Rik UTSW 7 125865262 missense probably damaging 1.00
R7561:D430042O09Rik UTSW 7 125842722 missense probably benign
R7571:D430042O09Rik UTSW 7 125708021 unclassified probably benign
R7584:D430042O09Rik UTSW 7 125870666 missense probably damaging 0.99
R7629:D430042O09Rik UTSW 7 125795250 missense probably damaging 0.96
R7676:D430042O09Rik UTSW 7 125850377 missense probably benign 0.26
R7748:D430042O09Rik UTSW 7 125829801 missense probably benign 0.00
R7786:D430042O09Rik UTSW 7 125865294 missense probably benign 0.19
R8058:D430042O09Rik UTSW 7 125843016 missense probably benign 0.17
R8154:D430042O09Rik UTSW 7 125813630 missense probably damaging 0.98
R8204:D430042O09Rik UTSW 7 125850742 missense probably damaging 1.00
U24488:D430042O09Rik UTSW 7 125770681 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATGGCATCTACCACTGTGGC -3'
(R):5'- TAGGAACAGCTTGAAGGGCC -3'

Sequencing Primer
(F):5'- ACCACTGTGGCTTTCTTCTCCAG -3'
(R):5'- TGCATTTCAGGACAAGGTCTCAC -3'
Posted On2020-09-02